Previous Contig 013591:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005C11Sequence335012540 (4)gb:DOB555127_16759913e-36Digitalis obscura p5Br gene for putative progesterone 5-beta-reductase, exons 1-115013591 (4)
JMSF024K03Sequence691004681 (5)gb:AY099787_15768126e-37Arabidopsis thaliana unknown protein (At2g15860) mRNA, complete cds.>gb:AY128904789013591 (4)gb:AY099787_15768123e-51Arabidopsis thaliana unknown protein (At2g15860) mRNA, complete cds.>gb:AY128904
JMSF031C02Sequence599004681 (5)gb:AY099787_15768121e-17Arabidopsis thaliana unknown protein (At2g15860) mRNA, complete cds.>gb:AY128904702013591 (4)gb:AY099787_15768123e-38Arabidopsis thaliana unknown protein (At2g15860) mRNA, complete cds.>gb:AY128904
JMSF045B16Sequence755004681 (5)gb:AY099787_15768127e-43Arabidopsis thaliana unknown protein (At2g15860) mRNA, complete cds.>gb:AY128904715013591 (4)gb:AY099787_15768124e-30Arabidopsis thaliana unknown protein (At2g15860) mRNA, complete cds.>gb:AY128904

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024K03+ TGGCTGCTGGTTTTACAAATGC
                      ____________________________________________________________
consensus TGGCTGCTGGTTTTACAAATGC
 
. : . : . : . : . : . :
rJMSF024K03+ TTNGGCTGGACTAGCTCCAAATGATATGATACAACGGACTGTGGGGAGACTGGAATCTCT
                      ____________________________________________________________
consensus TTNGGCTGGACTAGCTCCAAATGATATGATACAACGGACTGTGGGGAGACTGGAATCTCT
 
. : . : . : . : . : . :
rJMSF024K03+ CCACTCTGAGGGTGTTCATAGGCTTTCAGAA-GTGTGTTGCTCTGCTGTTA-CCCAAATT
rJMSF031C02+ GGGTGTTCATAGGCTTTCAGAA-GTGTGTTGCTCTGCTGTTA-CCCAAATT
rJMSF045B16+ GGGTGTTCATAGGCTTTCAGAANGTGTGTTGCTCTGCTGTTACCCCAAATT
                      ____________________________________________________________
consensus CCACTCTGAGGGTGTTCATAGGCTTTCAGAA-GTGTGTTGCTCTGCTGTTA-CCCAAATT
 
. : . : . : . : . : . :
rJMSF024K03+ CTCTTGCTTGGGAAATCTATCACATCTGATGCAAACAAGACTCAGAGTCCGGATGAGGAT
rJMSF031C02+ CTCTTGCTTGGGAAATCTATCACATCTGATGCAAACAAGACTCAGAGTCCGGATGAGGAT
rJMSF045B16+ CTCTTGCTTGGGAAATCTATCACATCTGATGCAAACAAGACTCAGAGTCCGGATGAGGAT
                      ____________________________________________________________
consensus CTCTTGCTTGGGAAATCTATCACATCTGATGCAAACAAGACTCAGAGTCCGGATGAGGAT
 
. : . : . : . : . : . :
rJMSF024K03+ GTTAATGAAGTGGATATGGTGAAAATTAATTGGCCTGAGGATTCTATTGAAAAAGCTAAG
rJMSF031C02+ GTTAATGAAGTGGATATGGTGAAAATTAATTGGCCTGAGGATTCTATTGAAAAAGCTAAG
rJMSF045B16+ GTTAATGAAGTGGATATGGTGAAAATTAATTGGCCTGAGGATTCTATTGAAAAAGCTAAG
                      ____________________________________________________________
consensus GTTAATGAAGTGGATATGGTGAAAATTAATTGGCCTGAGGATTCTATTGAAAAAGCTAAG
 
. : . : . : . : . : . :
rJMSF024K03+ ATTATCCGAGCGAGGGCAGAATTGATGACTGCAAGTGTTGAGGCAGTCTGTTCCAGTTTT
rJMSF031C02+ ATTATCCGAGCGAGGGCAGAATTGATGACTGCAAGTGTTGAGGCAGTCTGTTCCAGTTTT
rJMSF045B16+ ATTATCCGAGCGAGGGCAGAATTGATGACTGCAAGTGTTGAGGCAGTCTGTTCCAGTTTT
                      ____________________________________________________________
consensus ATTATCCGAGCGAGGGCAGAATTGATGACTGCAAGTGTTGAGGCAGTCTGTTCCAGTTTT
 
. : . : . : . : . : . :
rJMSF024K03+ ATTACAGGTATATCTGATGTGACAGAGGCATATTTAGATGCAATCAAAGCTGCTTCTGCT
rJMSF031C02+ ATTACAGGTATATCTGATGTGACAGAGGCATATTTAGATGCAATCAAAGCTGCTTCTGCT
rJMSF045B16+ ATTACAGGTATATCTGATGTGACAGAGGCATATTTAGATGCAATCAAAGCTGCTTCTGCT
                      ____________________________________________________________
consensus ATTACAGGTATATCTGATGTGACAGAGGCATATTTAGATGCAATCAAAGCTGCTTCTGCT
 
. : . : . : . : . : . :
rJMSF024K03+ GATTCGCATGAAACTCCCCAGAAAACAATTCAGGACAAAGTTAATGCTTTTTCAAAGGAT
rJMSF031C02+ GATTCGCATGAAACTCCCCAGAAAACAATTCAGGACAAAGTTAATGCTTTTTCAAAGGAT
rJMSF045B16+ GATTCGCATGAAACTCCCCAGAAAACAATTCAGGACAAAGTTAATGCTTTTTCAAAGGAT
                      ____________________________________________________________
consensus GATTCGCATGAAACTCCCCAGAAAACAATTCAGGACAAAGTTAATGCTTTTTCAAAGGAT
 
. : . : . : . : . : . :
rJMSF024K03+ CTCAGTGCAGATCAGAGCACAGCTATTGGAAAAATTCAGGATGGGCTTCAATACTTGTCT
rJMSF031C02+ CTCAGTGCAGATCAGAGCACAGCTATTGGAAAAATTCAGGATGGGCTTCAATACTTGTCT
rJMSF045B16+ CTCAGTGCAGATCAGAGCACAGCTATTGGAAAAATTCAGGATGGGCTTCAATACTTGTCT
                      ____________________________________________________________
consensus CTCAGTGCAGATCAGAGCACAGCTATTGGAAAAATTCAGGATGGGCTTCAATACTTGTCT
 
. : . : . : . : . : . :
rJMSF024K03+ TATTTGGTCATCTCTACTTCGATGCCTGCTGCCTGAGAATTAGTAGATTCACACGCTGGT
rJMSF031C02+ TATTTGGTCATCTCTACTTCGATGCCTGCTGCCTGAGAATTAGTAGATTCACACGCTGGT
rJMSF045B16+ TATTTGGTCATCTCTACTTCGATGCCTGCTGCCTGAGAATTAGTAGATTCACACGCTGGT
                      ____________________________________________________________
consensus TATTTGGTCATCTCTACTTCGATGCCTGCTGCCTGAGAATTAGTAGATTCACACGCTGGT
 
. : . : . : . : . : . :
rJMSF005C11+ TTTTAGTTTCTCGGNGTAAATAGTTATGCTTAGAAGTTGATTCGCTTG
rJMSF024K03+ ATGGGATTCTATTTTTAGTTTCTCGGTGTAAATAGTTATGCTTAGAAGTTGATTCGCTTG
rJMSF031C02+ ATGGGATTCTATTTTTAGTTTCTCGGTGTAAATAGTTATGCTTAGAAGTTGATTCGCTTG
rJMSF045B16+ ATGGGATTCTATTTTTAGTTTCTCGGTGTAAATAGTTATGCTTAGAAGTTGATTCGCTTG
                      ____________________________________________________________
consensus ATGGGATTCTATTTTTAGTTTCTCGGTGTAAATAGTTATGCTTAGAAGTTGATTCGCTTG
 
. : . : . : . : . : . :
rJMSF005C11+ TTCTTTATACTGGCNCCCTTTAAGTTTGCCNGTTCCGCTAAATCGAAGAATTATACCCTC
rJMSF024K03+ TTCTTTATACTGGCGCCCTTTAAGTTTG-CTGTTCCGATAAATCGAAGAATTATACCCTC
rJMSF031C02+ TTCTTTATACTGGCGCCCTTTAAGTTTG-CTGTTCCGATAAATCGAAGAATTATACCCTC
rJMSF045B16+ TTCTTTATACTGGCGCCCTTTAAGTTTG-CTGTTCCGATAAATCGAAGAATTATACCCTC
                      ____________________________________________________________
consensus TTCTTTATACTGGCGCCCTTTAAGTTTG-CTGTTCCGATAAATCGAAGAATTATACCCTC
 
. : . : . : . : . : . :
rJMSF024K03+ CTAAGTTCTAAATCATTGTTACTGGTGCCTGGTGGGCATGTATCTACTCTAAGTTACAGA
rJMSF031C02+ CTAAGTTCTAAATCATTGTTACTGGTGCCTGGTGGGCATGTATCTACTCTAAGTTACAGA
rJMSF045B16+ CTAAGTTCTAAATCATTGTTACTGGTGCCTGGTGGGCATGTATCTACTCTAAGTTACAGA
                      ____________________________________________________________
consensus CTAAGTTCTAAATCATTGTTACTGGTGCCTGGTGGGCATGTATCTACTCTAAGTTACAGA
 
. : . : . : . : . : . :
rJMSF024K03+ CCCTCTCCATTTTCCCCCTGTTTTTTTTTCTGAAGGGAAGATAC
rJMSF031C02+ CCCTCTCCATTTTCCCCCTG-TTTTTTTTCTGAAGGGAAGATAC
rJMSF045B16+ CCCTCTCCATTTTCCCCCTG-TTTTTTTTCTGAAGGGAAGATACCAGATATTGTATGGAT
                      ____________________________________________________________
consensus CCCTCTCCATTTTCCCCCTG-TTTTTTTTCTGAAGGGAAGATACCAGATATTGTATGGAT