Previous Contig 013579:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF003E20Sequence417005322 (3)gb:AF273333_17823506e-04Lycopersicon esculentum clone BAC 19, complete sequence.721013579 (3)gb:AF273333_17823502e-25Lycopersicon esculentum clone BAC 19, complete sequence.
JMSF012I05Sequence554005322 (3)gb:AF273333_17823504e-11Lycopersicon esculentum clone BAC 19, complete sequence.710013579 (3)gb:AF273333_17823502e-25Lycopersicon esculentum clone BAC 19, complete sequence.
JMSF044P03Sequence755005322 (3)gb:AF273333_17823508e-44Lycopersicon esculentum clone BAC 19, complete sequence.669013579 (3)gb:AF273333_17823503e-24Lycopersicon esculentum clone BAC 19, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003E20+ TGCTCGACCA
                      ____________________________________________________________
consensus TGCTCGACCA
 
. : . : . : . : . : . :
rJMSF012I05+ GGGAAATGCCAGAGAAGCAACCGCTGCAGCAATGGGTGTTGATGCTCCTCCAGAGGAG
rJMSF003E20+ AAGGGAAATGCCAGAGAAGCAACCGCTGCAGCAATGGGTGTTGATGCTCCTCCAGAGGAG
rJMSF044P03+ CCAGAGGAG
                      ____________________________________________________________
consensus AAGGGAAATGCCAGAGAAGCAACCGCTGCAGCAATGGGTGTTGATGCTCCTCCAGAGGAG
 
. : . : . : . : . : . :
rJMSF012I05+ CTTCAGGCAATTATAAATCAGGTTGCTGTAAATATACATGGTGTCTATGTTTTGAAGTCA
rJMSF003E20+ CTTCAGGCAATTATAAATCAGGTTGCTGTAAATATACATGGTGTCTATGTTTTGAAGTCA
rJMSF044P03+ CTTCAGGCAATTATAAATCAGGTTGCTGTAAATATACATGGTGTCTATGTTTNGAAGTCA
                      ____________________________________________________________
consensus CTTCAGGCAATTATAAATCAGGTTGCTGTAAATATACATGGTGTCTATGTTTTGAAGTCA
 
. : . : . : . : . : . :
rJMSF012I05+ TCACCCGATTTTCCGCAGTATGATGCATTAAGGAAGGTGGTGATTGCTCTTTTAATTGCA
rJMSF003E20+ TCACCCGATTTTCCGCAGTATGATGCATTAAGGAAGGTGGTGATTGCTCTTTTAATTGCA
rJMSF044P03+ TCACCCGATTTTCCGCAGTATGATGCATTAAGGAAGGTGGTGATTGCTCTTTTAATTGCA
                      ____________________________________________________________
consensus TCACCCGATTTTCCGCAGTATGATGCATTAAGGAAGGTGGTGATTGCTCTTTTAATTGCA
 
. : . : . : . : . : . :
rJMSF012I05+ GAAGGTCCTAATGCAAAGCTTAAAAGGGCTTCAGTTATTGAGGCTGCTAGGTTGCAACTT
rJMSF003E20+ GAAGGTCCTAATGCAAAGCTTAAAAGGGCTTCAGTTATTGAGGCTGCTAGGTTGCAACTT
rJMSF044P03+ GAAGGTCCTAATGCAAAGCTTAAAAGGGCTTCAGTTATTGAGGCTGCTAGGTTGCAACTT
                      ____________________________________________________________
consensus GAAGGTCCTAATGCAAAGCTTAAAAGGGCTTCAGTTATTGAGGCTGCTAGGTTGCAACTT
 
. : . : . : . : . : . :
rJMSF012I05+ AACAAGGATATTACAGACACGGAGTTTCAGAAGGTTGTATCGGAGCTATGCGTATCACAA
rJMSF003E20+ AACAAGGATATTACAGACACGGAGTTTCAGAAGGTTGTATCGGAGCTATGCGTATCACAA
rJMSF044P03+ AACAAGGATATTACAGACACGGAGTTTCAGAAGGTTGTATCGGAGCTATGCGTATCACAA
                      ____________________________________________________________
consensus AACAAGGATATTACAGACACGGAGTTTCAGAAGGTTGTATCGGAGCTATGCGTATCACAA
 
. : . : . : . : . : . :
rJMSF012I05+ AGTTCGGGTTGGGTTCTGAAACGCGGTGATGGAAGTCCAAAATAGCACTTTCAGAGCGCC
rJMSF003E20+ AGTTCGGGTTGGGTTCTGAAACGCGGTGATGGAAGTCCAAAATAGCACTTTCAGAGCGCC
rJMSF044P03+ AGTTCGGGTTGGGTTCTGAAACGCGGTGATGGAAGTCCAAAATAGCACTTTCAGAGCGCC
                      ____________________________________________________________
consensus AGTTCGGGTTGGGTTCTGAAACGCGGTGATGGAAGTCCAAAATAGCACTTTCAGAGCGCC
 
. : . : . : . : . : . :
rJMSF012I05+ TATCAACTGTTGGAGCATATTTTTGCATTAAATTCCAGGAACTCCATAGTTCCAAAGATC
rJMSF003E20+ TATCAACTGTTGGAGCATATTTTTGCATTAAATTCCAGGAACTCCATAGTTCCAAAGATC
rJMSF044P03+ TATCAACTGTTGGAGCATATTTTTGCATTAAATTCCAGGAACTCCATAGTTCCAAAGATC
                      ____________________________________________________________
consensus TATCAACTGTTGGAGCATATTTTTGCATTAAATTCCAGGAACTCCATAGTTCCAAAGATC
 
. : . : . : . : . : . :
rJMSF012I05+ ATTCTTCAACCTTGTATAACATGTTGAGATGTCAGCTATGATATAATGGATGCCATTGCC
rJMSF003E20+ ATTCTTCAACCTTGTATAACATGTTGAGATGTCAGCTATGATATAATGGATGCCATTGCC
rJMSF044P03+ ATTCTTCAACCTTGTATAACATGTTGAGATGTCAGCTATGATATAATGGATGCCATTGCC
                      ____________________________________________________________
consensus ATTCTTCAACCTTGTATAACATGTTGAGATGTCAGCTATGATATAATGGATGCCATTGCC
 
. : . : . : . : . : . :
rJMSF012I05+ ATGTCGGGTGCTTTGCCGATATTACCTTCGGGAACTATTTGCTGCATCGGAAAGGTCAAG
rJMSF003E20+ ATGTCGGGTGCTTTGCCGATATTACCTTCGGGAACTATTTGCTGCATCGGAAAGGTCAAG
rJMSF044P03+ ATGTCGGGTGCTTTGCCGATATTACCTTCGGGAACTATTTGCTGCATCGGAAAGGTCAAG
                      ____________________________________________________________
consensus ATGTCGGGTGCTTTGCCGATATTACCTTCGGGAACTATTTGCTGCATCGGAAAGGTCAAG
 
. : . : . : . : . : . :
rJMSF012I05+ ATGAACTCGGGGATCAAATTTGGACAACTTCTAATAGCTCAAGGCCTGAAATTCATAGTT
rJMSF003E20+ ATGAACTCGGGGATCAAATTTGGACAACTTCTAATAGCTCAAGGCCTGAAATTCATAGTT
rJMSF044P03+ ATGAACTCGGGGATCAAATTTGGACAACTTCTAATAGCTCAAGGCCTGAAATTCATAGTT
                      ____________________________________________________________
consensus ATGAACTCGGGGATCAAATTTGGACAACTTCTAATAGCTCAAGGCCTGAAATTCATAGTT
 
. : . : . : . : . : . :
rJMSF012I05+ TGGCACTCAACATGAAAAATCATAGTGAATCTAGTGACAGGTTTTATTATTATTATTTTT
rJMSF003E20+ TGGCACTCAACATGAAAAATCATAGTGAATCTAGTGACAGGTTTTATTATTATTATTTTT
rJMSF044P03+ TGGCACTCAACATGAAAAATCATAGTGAATCTAGTGACAGGTTTTATTATTATTATTTTT
                      ____________________________________________________________
consensus TGGCACTCAACATGAAAAATCATAGTGAATCTAGTGACAGGTTTTATTATTATTATTTTT
 
. : . : . : . : . : . :
rJMSF012I05+ TTGTTTATTTATAAAAAACCCATTTTTGTTGTTTGCTTTGAA
rJMSF003E20+ TTGTTTATTTATAAAAAACCCATTTTTGTTGTTTGCTTTGAA
rJMSF044P03+ TTGTTTATTTATAAAAAACCCATTTTTGTTGTTTGCTTTGAACGATTGAANCCTTGTGCA
                      ____________________________________________________________
consensus TTGTTTATTTATAAAAAACCCATTTTTGTTGTTTGCTTTGAACGATTGAANCCTTGTGCA