Previous Contig 013578:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016O13Sequence221000864 (3)264013578 (4)pir|T08904|T089043e-21probable long-chain-fatty-acid-CoA ligase (EC 6.2.1.3) T32A16.20 - Arabidopsis t
JMFF045O13Sequence630015022pir|A84720|A847205e-24hypothetical protein At2g31380 [imported] - Arabidopsis thaliana589013578 (4)gb:AP003212_18252832e-47Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMSF044P02Sequence400013578 (4)gb:CAR6025_16454328e-06Cicer arietinum mRNA for acyl-coA synthetase, partial.
JMSF051M17Sequence104000864 (3)729013578 (4)gb:AP003212_18252833e-89Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051M17+ TGNTCCTGAGATGGGGTACGATGCTCTATCAGACGTACCACGCGGTGAAGTATGTG
                      ____________________________________________________________
consensus TGNTCCTGAGATGGGGTACGATGCTCTATCAGACGTACCACGCGGTGAAGTATGTG
 
. : . : . : . : . : . :
rJMSF051M17+ TGAGGGGCGATACGGTTTTTTCAGGTTACTACAAGCGCGAAGATCTTACAAAGGAGGTCC
                      ____________________________________________________________
consensus TGAGGGGCGATACGGTTTTTTCAGGTTACTACAAGCGCGAAGATCTTACAAAGGAGGTCC
 
. : . : . : . : . : . :
rJMSF051M17+ TGGTTGATGGGTGGTTCCACACAGGTGATATTGGCGAGTGGCAACCGACTGGGGGCTTGA
                      ____________________________________________________________
consensus TGGTTGATGGGTGGTTCCACACAGGTGATATTGGCGAGTGGCAACCGACTGGGGGCTTGA
 
. : . : . : . : . : . :
rJMSF051M17+ AAATAATTGATCGTAAGAAGAACATTTTCAAGCTCTCACAAGGAGAATATGTTGCAGTGG
rJMFF045O13+ TGCAGTGG
                      ____________________________________________________________
consensus AAATAATTGATCGTAAGAAGAACATTTTCAAGCTCTCACAAGGAGAATATGTTGCAGTGG
 
. : . : . : . : . : . :
rJMSF051M17+ AAAATCTAGAGAATGTATATGGACAAGTCTCGGTTATTGACTCCATTTGGATATACGGGA
rJMFF045O13+ AAAATCTAGAGAATGTATATGGACAAGTCTCGGTTATTGACTCCATTTGGATATACGGGA
                      ____________________________________________________________
consensus AAAATCTAGAGAATGTATATGGACAAGTCTCGGTTATTGACTCCATTTGGATATACGGGA
 
. : . : . : . : . : . :
rJMSF051M17+ ACAGCTTCGAGTCATTTCTCGTAGCAATTGTTAGCCCAAACAAGCCAGCAATTGAAAATT
rJMFF045O13+ ACAGCTTCGAGTCATTTCTCGTAGCAATTGTTAGCCCAAACAAGCCAGCAATTGAAAATT
                      ____________________________________________________________
consensus ACAGCTTCGAGTCATTTCTCGTAGCAATTGTTAGCCCAAACAAGCCAGCAATTGAAAATT
 
. : . : . : . : . : . :
rJMSF051M17+ GGGCTGAACAAAACGACATACCTGGAGATTTCGACTCCCTATGTGAAAATCCAAAGGTGA
rJMFF045O13+ GGGCTGAACAAAACGACATACCTGGAGATTTCGACTCCCTATGTGAAAATCCAAAGGTGA
                      ____________________________________________________________
consensus GGGCTGAACAAAACGACATACCTGGAGATTTCGACTCCCTATGTGAAAATCCAAAGGTGA
 
. : . : . : . : . : . :
rJMSF051M17+ AGGAGTACATACTCGAAGAGCTCAAGAAAATTGCCAAAGACAAGAAGTTGAAGGGCTTTG
rJMFF016O13+ AGAAGTTGAAGGGCTTTG
rJMFF045O13+ AGGAGTACATACTCGAAGAGCTCAAGAAAATTGCCAAAGACAAGAAGTTGAAGGGCTTTG
rJMSF044P02+ AAATTGCCNAAGACNAGAAGTTGAAGGGCTTTG
                      ____________________________________________________________
consensus AGGAGTACATACTCGAAGAGCTCAAGAAAATTGCCAAAGACAAGAAGTTGAAGGGCTTTG
 
. : . : . : . : . : . :
rJMSF051M17+ AGATAATAAAGTCTGTGCACCTTGATCCCGTTCCATTCGACATGGAACGCGATCTTCTCA
rJMFF016O13+ AGATAATAAAGTCTGTGCACCTTGATCCCGTTCCATTCGACATGGAACGCGATCTTCTCA
rJMFF045O13+ AGATAATAAAGTCTGTGCACCTTGATCCCGTTCCATTCGACATGGAACGCGATCTTCTCA
rJMSF044P02+ NGATNATAAAGTCTGTGCNCCTTGATCCCGTTCCCTTNGNCNTGGAACNCGATNTTNTCN
                      ____________________________________________________________
consensus AGATAATAAAGTCTGTGCACCTTGATCCCGTTCCATTCGACATGGAACGCGATCTTCTCA
 
. : . : . : . : . : . :
rJMSF051M17+ CCCCGACATTCAAGAAGAAAAGACCGCAGTTGCTAAAATACTATCAGAGTGTGATTGACA
rJMFF016O13+ CCCCGACATTCAAGAAGAAAAGACCGCAGTTGCTAAAATACTATCAGAGTGTGATTGACA
rJMFF045O13+ CCCCGACATTCAAGAAGAAAAGACCGCAGTTGCTAAAATACTATCAGAGTGTGATTGACA
rJMSF044P02+ CCCCGNCNTTCNAGAAGAAAAGNCCGCNGTTGCTAAAATNCTATCCGNGNGNGNTTGNCN
                      ____________________________________________________________
consensus CCCCGACATTCAAGAAGAAAAGACCGCAGTTGCTAAAATACTATCAGAGTGTGATTGACA
 
. : . : . : . : . : . :
rJMSF051M17+ ACATGTACAAGAGTGCTAAATGAGCTTCATGGTGAAGAATAGTGACTGAGTTTCATCTTT
rJMFF016O13+ ACATGTACAAGAGTGCTAAATGAGCTTCATGGTGAAGAATAGTGACTGAGTTTCATCTTT
rJMFF045O13+ ACATGTACAAGAGTGCTAAATGAGCTTCATGGTGAAGAATAGTGACTGAGTTTCATCTTT
rJMSF044P02+ ACNTGTNCCAGNGTGCTAAATGAGNTTCCTGGTGAAGAATAGNGNCTGAGTTTCATNTTT
                      ____________________________________________________________
consensus ACATGTACAAGAGTGCTAAATGAGCTTCATGGTGAAGAATAGTGACTGAGTTTCATCTTT
 
. : . : . : . : . : . :
rJMSF051M17+ TTTACTGCATCCTCTCTAATCTCTGTGTTTTTTATAATGTCATTATTGTACATACAAAAT
rJMFF016O13+ TTTACTGCATCCTCTCTAATCTCTGTGTTTTTTATAATGTCATTATTG
rJMFF045O13+ TTTACTGCATCCTCTCTAATCTCTGTGTTTTTTATAATGTCATTATTGTACATACAAAAT
rJMSF044P02+ TTTACTGCNTCCNCTNTAATCTCTGNGTTTTTTATAANGTCNTTATTGNACNTACNAAAT
                      ____________________________________________________________
consensus TTTACTGCATCCTCTCTAATCTCTGTGTTTTTTATAATGTCATTATTGTACATACAAAAT
 
. : . : . : . : . : . :
rJMSF051M17+ TTAATAAAAG
rJMFF045O13+ TTAATAAAAGATTTTATTATGTGTAATACGAAAGAAAGTTGTTGGTGGTGGATTTTTCAT
rJMSF044P02+ TTAATAAAAGNTTTTNTTATGTGTAATNCGAAAGAAAGTTGTTGGNGGNGGATTTTTCCT
                      ____________________________________________________________
consensus TTAATAAAAGATTTTATTATGTGTAATACGAAAGAAAGTTGTTGGTGGTGGATTTTTCCT
 
. : . : . : . : . : . :
rJMFF045O13+ TTCCTTTATTATTAAGGAAAATATAGTGTATTGTTAGGG
rJMSF044P02+ TTCCNTTATTATTAAGGAAAATATAGTGTATTGTTAGGGNGAAACTCTCCCCCTATGTTC
                      ____________________________________________________________
consensus TTCCTTTATTATTAAGGAAAATATAGTGTATTGTTAGGGNGAAACTCTCCCCCTATGTTC