Previous Contig 013574:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN006B01Sequence616013574 (2)
JMSF044O14Sequence723020270pir|T02238|T022382e-64glucosyl transferase, jasmonate-induced - common tobacco>gb:AB000623_1508418 Nic639013574 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN006B01+ AATGTTAAGCTGTCCAACCACTTACTTTATGTCTAAATCAATGATACTC
                      ____________________________________________________________
consensus AATGTTAAGCTGTCCAACCACTTACTTTATGTCTAAATCAATGATACTC
 
. : . : . : . : . : . :
JMFN006B01+ ACAAGCTGTGGTCTGTGGATATGTTAAGTCTTCCCACTAATGATTTGATGCTTGAAAAAT
                      ____________________________________________________________
consensus ACAAGCTGTGGTCTGTGGATATGTTAAGTCTTCCCACTAATGATTTGATGCTTGAAAAAT
 
. : . : . : . : . : . :
JMFN006B01+ GTAACATTGAATATTGATTATGTTGAACACACCCTCCATTTTGGGTTGCCTCAATTATTG
                      ____________________________________________________________
consensus GTAACATTGAATATTGATTATGTTGAACACACCCTCCATTTTGGGTTGCCTCAATTATTG
 
. : . : . : . : . : . :
JMFN006B01+ AAAATTTTTAGAAAAGAAAAGTTTTGGTTTTAATAATAATAATAATTATTATTATAATGT
                      ____________________________________________________________
consensus AAAATTTTTAGAAAAGAAAAGTTTTGGTTTTAATAATAATAATAATTATTATTATAATGT
 
. : . : . : . : . : . :
JMFN006B01+ TGATTCTTGTGGGTGCACATCTCATTTCATGACTAGACTTTTCATTTTCTTTGCCTTAGT
                      ____________________________________________________________
consensus TGATTCTTGTGGGTGCACATCTCATTTCATGACTAGACTTTTCATTTTCTTTGCCTTAGT
 
. : . : . : . : . : . :
JMFN006B01+ GCTTGCATTCCTACCCCTCAATTTTTTCTCCCCTTTTGCTTCACCTCCGCCCACTACACC
                      ____________________________________________________________
consensus GCTTGCATTCCTACCCCTCAATTTTTTCTCCCCTTTTGCTTCACCTCCGCCCACTACACC
 
. : . : . : . : . : . :
JMFN006B01+ TACAAACACAATACAATTTGTATTTTGGGAAATATATGCATAAAGATATGATGCTATATA
                      ____________________________________________________________
consensus TACAAACACAATACAATTTGTATTTTGGGAAATATATGCATAAAGATATGATGCTATATA
 
. : . : . : . : . : . :
JMFN006B01+ TATATATATATATATATATATATAGGGAAGGGATCAGGTGCATTTGAGGCTTCCCGTGCG
rJMSF044O14+ TATATATATATATATAGGGAAGGGATCAGGTGCATTTGTTGCTTCCCGTGCG
                      ____________________________________________________________
consensus TATATATATATATATATATATATAGGGAAGGGATCAGGTGCATTTGTTGCTTCCCGTGCG
 
. : . : . : . : . : . :
JMFN006B01+ GTTGTGC
rJMSF044O14+ GATGTGCGGTGGATTAACGTGCGTGAGCTTTATACTTAATGTGCGTGAGATTTGTACTCA
                      ____________________________________________________________
consensus GTTGTGCGGTGGATTAACGTGCGTGAGCTTTATACTTAATGTGCGTGAGATTTGTACTCA
 
. : . : . : . : . : . :
rJMSF044O14+ ATGTGCCTGAGATTTGTACTTAATGTGTGTCATGTTAATAAGCGTGAGTTTTGTACTTAA
                      ____________________________________________________________
consensus ATGTGCCTGAGATTTGTACTTAATGTGTGTCATGTTAATAAGCGTGAGTTTTGTACTTAA
 
. : . : . : . : . : . :
rJMSF044O14+ TGTGCCTGAGTATTGTGTTTAATGTGCGTGAGATTTGTGCTTAATGTGCGTGCGTTTTCA
                      ____________________________________________________________
consensus TGTGCCTGAGTATTGTGTTTAATGTGCGTGAGATTTGTGCTTAATGTGCGTGCGTTTTCA
 
. : . : . : . : . : . :
rJMSF044O14+ GAATTACGAGCTCAGAAGGAAGCAGAACAGAAACTCACGCACATTAACGCCCAAGCTTCT
                      ____________________________________________________________
consensus GAATTACGAGCTCAGAAGGAAGCAGAACAGAAACTCACGCACATTAACGCCCAAGCTTCT
 
. : . : . : . : . : . :
rJMSF044O14+ TGTTACTTCTTCCTTCAATTTGGCCATGGATTCTGGATTATCAGCTACCTTCAGTGCAGT
                      ____________________________________________________________
consensus TGTTACTTCTTCCTTCAATTTGGCCATGGATTCTGGATTATCAGCTACCTTCAGTGCAGT
 
. : . : . : . : . : . :
rJMSF044O14+ TTAATGTTTATATAAATGACGTACGCACAGTAAAATTCGCAGAGCAGCTAAGTGTTGATT
                      ____________________________________________________________
consensus TTAATGTTTATATAAATGACGTACGCACAGTAAAATTCGCAGAGCAGCTAAGTGTTGATT