Previous Contig 013572:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF044N24Sequence722013572 (2)gb:AB040471_15195143e-55Nicotiana tabacum mRNA for bZIP transcriptional activator RSG, complete cds.706013572 (2)gb:AB040471_15195149e-66Nicotiana tabacum mRNA for bZIP transcriptional activator RSG, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044N24- GGCGTGGCACGGCTTGGCAGTGTATTAGACCGCGTAACTATGGGTCCCACTTTACACCTT
                      ____________________________________________________________
consensus GGCGTGGCACGGCTTGGCAGTGTATTAGACCGCGTAACTATGGGTCCCACTTTACACCTT
 
. : . : . : . : . : . :
JMSF044N24- CCCTTATGTTCCCTTTCCCCATTTTTTCAACCCCCAAAATTTTCACTTCAAAGATTCTGC
                      ____________________________________________________________
consensus CCCTTATGTTCCCTTTCCCCATTTTTTCAACCCCCAAAATTTTCACTTCAAAGATTCTGC
 
. : . : . : . : . : . :
JMSF044N24- TTTCAGATGATGGACCCGAAGTTCGCCGGAAAGTTCACGCCGGCGCAGTACTTAGTTGGC
                      ____________________________________________________________
consensus TTTCAGATGATGGACCCGAAGTTCGCCGGAAAGTTCACGCCGGCGCAGTACTTAGTTGGC
 
. : . : . : . : . : . :
JMSF044N24- CGGACGGACCTCGACCAGATGCCCGACACCCCAACCCGCGGGTCCCGCCACCGCCGGACC
                      ____________________________________________________________
consensus CGGACGGACCTCGACCAGATGCCCGACACCCCAACCCGCGGGTCCCGCCACCGCCGGACC
 
. : . : . : . : . : . :
JMSF044N24- CAGTCCGAGACCTTCTTCCGGTTCCCGGACTTGGACGATGACATCATGCTCGACGACGTC
                      ____________________________________________________________
consensus CAGTCCGAGACCTTCTTCCGGTTCCCGGACTTGGACGATGACATCATGCTCGACGACGTC
 
. : . : . : . : . : . :
JMSF044N24- GTTGGAGACTTCAACCACGACGCCCTCGCCGACACCGCCATGCAGCCGGCAAACTCGGCC
                      ____________________________________________________________
consensus GTTGGAGACTTCAACCACGACGCCCTCGCCGACACCGCCATGCAGCCGGCAAACTCGGCC
 
. : . : . : . : . : . :
JMSF044N24- GACTCGTCCTCCACCGGGCCGCCGCGATCGGCCGGGCCGTTCTTTGACCATAAGCCGGCG
                      ____________________________________________________________
consensus GACTCGTCCTCCACCGGGCCGCCGCGATCGGCCGGGCCGTTCTTTGACCATAAGCCGGCG
 
. : . : . : . : . : . :
JMSF044N24- ACCCATTTCCGCAGCCTTTCCGTTGACTCCGACTTCTTCGATGGTCTGGAGCTGGGCCCT
                      ____________________________________________________________
consensus ACCCATTTCCGCAGCCTTTCCGTTGACTCCGACTTCTTCGATGGTCTGGAGCTGGGCCCT
 
. : . : . : . : . : . :
JMSF044N24- TCGTCCGCTGTCGGCGGCGGAGCAACCAACCCACTCTCGTCGGAGAAGATGGCGATGGGT
                      ____________________________________________________________
consensus TCGTCCGCTGTCGGCGGCGGAGCAACCAACCCACTCTCGTCGGAGAAGATGGCGATGGGT
 
. : . : . : . : . : . :
JMSF044N24- CCGGGCCCACGCCACAGGCACAGTAGCTCGATGGATGGGTCTTTCGCTACGGCGTCGTTC
                      ____________________________________________________________
consensus CCGGGCCCACGCCACAGGCACAGTAGCTCGATGGATGGGTCTTTCGCTACGGCGTCGTTC
 
. : . : . : . : . : . :
JMSF044N24- GAGGTCGATTCCATCTCGGAGAAGAAAGCTATGGAAGCTGACAGACTTGCAGAGCTTGCC
rJMSF044N24+ CTCGGAGAAGAAAGCTATGGAAGCTGACAGACTTGCAGAGCTTGCC
                      ____________________________________________________________
consensus GAGGTCGATTCCATCTCGGAGAAGAAAGCTATGGAAGCTGACAGACTTGCAGAGCTTGCC
 
. : . : . : . : . : . :
JMSF044N24- TTGATTGACCCTAAGAGAGCTAAAAGGATTCTAGCAAACCGGCAATCTGCAGCGCGTTCA
rJMSF044N24+ TTGATTGACCCTAAGAGAGCTAAAAGGATTCTAGCAAACCGGCAATCTGCAGCGCGTTCA
                      ____________________________________________________________
consensus TTGATTGACCCTAAGAGAGCTAAAAGGATTCTAGCAAACCGGCAATCTGCAGCGCGTTCA
 
. : . : . : . : . : . :
JMSF044N24- AA
rJMSF044N24+ AAGGAGCGAAAGATTCGCTACACAAGTGAGCTGGAGAGGAAAGTGCAGACACTGCAGACT
                      ____________________________________________________________
consensus AAGGAGCGAAAGATTCGCTACACAAGTGAGCTGGAGAGGAAAGTGCAGACACTGCAGACT
 
. : . : . : . : . : . :
rJMSF044N24+ GAAGCAACTACTCTCTCTGCACAGATTACTCACCTGCAGAGAGATACTTCTGGACTGACT
                      ____________________________________________________________
consensus GAAGCAACTACTCTCTCTGCACAGATTACTCACCTGCAGAGAGATACTTCTGGACTGACT
 
. : . : . : . : . : . :
rJMSF044N24+ GCTGAGAACAAAGAACTCAAACTGCGGTTACAGGCTTTGGAACAAGAAGCTCATCTTCGG
                      ____________________________________________________________
consensus GCTGAGAACAAAGAACTCAAACTGCGGTTACAGGCTTTGGAACAAGAAGCTCATCTTCGG
 
. : . : . : . : . : . :
rJMSF044N24+ GATGCTCTAAACGAAGCTCTGAAGGAAGAATTGCAGCGGCTTAAGATAGCAGCTGGGCAG
                      ____________________________________________________________
consensus GATGCTCTAAACGAAGCTCTGAAGGAAGAATTGCAGCGGCTTAAGATAGCAGCTGGGCAG
 
. : . : . : . : . : . :
rJMSF044N24+ GCTCAATCTGCCAATGGGAACAGCATGAACAGGGGACTGGGCCCTCAACTTCATCCGCAA
                      ____________________________________________________________
consensus GCTCAATCTGCCAATGGGAACAGCATGAACAGGGGACTGGGCCCTCAACTTCATCCGCAA
 
. : . : . : . : . : . :
rJMSF044N24+ TCACAGGCCTTTGTTCACTTTGGCAACCACGAAGCGCAGCAGCTTCACATGCCTCGTCCC
                      ____________________________________________________________
consensus TCACAGGCCTTTGTTCACTTTGGCAACCACGAAGCGCAGCAGCTTCACATGCCTCGTCCC
 
. : . : . : . : . : . :
rJMSF044N24+ ACCACGAGCATGCCAAATGTCGGTGGGCATCCCCAGCCTGGCTTCCTGGATTTCAATCAG
                      ____________________________________________________________
consensus ACCACGAGCATGCCAAATGTCGGTGGGCATCCCCAGCCTGGCTTCCTGGATTTCAATCAG
 
. : . : . : . : . : . :
rJMSF044N24+ AGGGCTTGATTACAATCTGAAGACTATAGCTACACAATTAATGTATCATATATAGCTTCA
                      ____________________________________________________________
consensus AGGGCTTGATTACAATCTGAAGACTATAGCTACACAATTAATGTATCATATATAGCTTCA
 
. : . : . : . : . : . :
rJMSF044N24+ TATATAAGTCATATAGATTATGGTTGCATAGAGTTGCTCTAATCAATTAGTTGTGTCTAT
                      ____________________________________________________________
consensus TATATAAGTCATATAGATTATGGTTGCATAGAGTTGCTCTAATCAATTAGTTGTGTCTAT
 
. : . : . : . : . : . :
rJMSF044N24+ TACTAATAGCAGCTTGTACCAATCTGAAGGGTAGAGGTTCTGTTAAGAATATCTTTCAAT
                      ____________________________________________________________
consensus TACTAATAGCAGCTTGTACCAATCTGAAGGGTAGAGGTTCTGTTAAGAATATCTTTCAAT