Previous Contig 013568:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF044N04Sequence698013568 (2)gb:AY085322_15703946e-27Arabidopsis thaliana clone 14562 mRNA, complete sequence.772013568 (2)gb:AY085322_15703944e-67Arabidopsis thaliana clone 14562 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044N04- GATTTTGATCCTTTCAACTCTTTCCATTTCCATTT
                      ____________________________________________________________
consensus GATTTTGATCCTTTCAACTCTTTCCATTTCCATTT
 
. : . : . : . : . : . :
JMSF044N04- TCCAATATTGAAACTACACTACACGCTTATCATTCACTTATAATTCTGTATATATGCACA
                      ____________________________________________________________
consensus TCCAATATTGAAACTACACTACACGCTTATCATTCACTTATAATTCTGTATATATGCACA
 
. : . : . : . : . : . :
JMSF044N04- CAAGTACAAATATACCACCTTCAATTTCAGCATTCAAGCTCTTTCTAGATTTCTTCTTTT
                      ____________________________________________________________
consensus CAAGTACAAATATACCACCTTCAATTTCAGCATTCAAGCTCTTTCTAGATTTCTTCTTTT
 
. : . : . : . : . : . :
JMSF044N04- TTCTGTCTCCAGTGTAGATCGGCTTTCTTGGAAAGCGTGCGTTAAATCTTGACACCGCGC
                      ____________________________________________________________
consensus TTCTGTCTCCAGTGTAGATCGGCTTTCTTGGAAAGCGTGCGTTAAATCTTGACACCGCGC
 
. : . : . : . : . : . :
JMSF044N04- CTTTGGATTCTCGGGATATATTCTTTTCTGTGGCTGTAGCAGTTGATCCTTCTGACATCC
                      ____________________________________________________________
consensus CTTTGGATTCTCGGGATATATTCTTTTCTGTGGCTGTAGCAGTTGATCCTTCTGACATCC
 
. : . : . : . : . : . :
JMSF044N04- TGATTTCATCCTGCAAAGTTTTGTGACTCAAAATGTTTGGTCTTAAGAAGTTGTCCCCCT
                      ____________________________________________________________
consensus TGATTTCATCCTGCAAAGTTTTGTGACTCAAAATGTTTGGTCTTAAGAAGTTGTCCCCCT
 
. : . : . : . : . : . :
JMSF044N04- TGAACAAGAATACTAGAAACCACTCAGTTGATCCTGGATTTCATACCTATTCTAATTCAA
                      ____________________________________________________________
consensus TGAACAAGAATACTAGAAACCACTCAGTTGATCCTGGATTTCATACCTATTCTAATTCAA
 
. : . : . : . : . : . :
JMSF044N04- ACCCTTTTGATTCTGATGATGAGTATGATAAGAAGCAAACTGTCAAAGCCTCAAGGAGTT
                      ____________________________________________________________
consensus ACCCTTTTGATTCTGATGATGAGTATGATAAGAAGCAAACTGTCAAAGCCTCAAGGAGTT
 
. : . : . : . : . : . :
JMSF044N04- CTTCAGAGCCTGCTCTAGTTGCTCCAAATTTGAGCACTAACCCCTTTGATGATGATGAGA
                      ____________________________________________________________
consensus CTTCAGAGCCTGCTCTAGTTGCTCCAAATTTGAGCACTAACCCCTTTGATGATGATGAGA
 
. : . : . : . : . : . :
JMSF044N04- CTAAAGTGGGGAAATCCTCATCAGCATACTCCTTCACTTCAGCAGACAGAAACAGATACA
                      ____________________________________________________________
consensus CTAAAGTGGGGAAATCCTCATCAGCATACTCCTTCACTTCAGCAGACAGAAACAGATACA
 
. : . : . : . : . : . :
JMSF044N04- AGAATGGTTTCCATGATTCAGGAGGATTGGAGAATCAATCTGTACAAGAATTGGAAAATT
                      ____________________________________________________________
consensus AGAATGGTTTCCATGATTCAGGAGGATTGGAGAATCAATCTGTACAAGAATTGGAAAATT
 
. : . : . : . : . : . :
JMSF044N04- ATGCTGTGTATAAAGCTGAAGAGACTACAAAATCAGTAAATGGCTGTTTGAAGATTGCTG
rJMSF044N04+ TATAAAGCTGAAGAGACTACAAAATCAGTAAATGGCTGTTTGAAGATTGCTG
                      ____________________________________________________________
consensus ATGCTGTGTATAAAGCTGAAGAGACTACAAAATCAGTAAATGGCTGTTTGAAGATTGCTG
 
. : . : . : . : . : . :
JMSF044N04- AAG
rJMSF044N04+ AAGAGATAAGAGAGGATGCCACTAAAACATTAATCACCCTACATCACCAGAGTGAGCAAA
                      ____________________________________________________________
consensus AAGAGATAAGAGAGGATGCCACTAAAACATTAATCACCCTACATCACCAGAGTGAGCAAA
 
. : . : . : . : . : . :
rJMSF044N04+ TTACTAGAACTCACATGACTGCTGCTGACATTGACTATGATCTTAGCAGGGGTGAAAAAC
                      ____________________________________________________________
consensus TTACTAGAACTCACATGACTGCTGCTGACATTGACTATGATCTTAGCAGGGGTGAAAAAC
 
. : . : . : . : . : . :
rJMSF044N04+ TTTTGGGCAGTCTTGGGGGCTTATTTTCCAAGACTTGGAAGCCTAAGAAGAATCGTCCAA
                      ____________________________________________________________
consensus TTTTGGGCAGTCTTGGGGGCTTATTTTCCAAGACTTGGAAGCCTAAGAAGAATCGTCCAA
 
. : . : . : . : . : . :
rJMSF044N04+ TAACAGGGCCTATCATCACTAAAGATGATCCAGTACCAAGGAGAGGTAACCACTTGGAGC
                      ____________________________________________________________
consensus TAACAGGGCCTATCATCACTAAAGATGATCCAGTACCAAGGAGAGGTAACCACTTGGAGC
 
. : . : . : . : . : . :
rJMSF044N04+ AGAGGGAGAAACTTGGATTGAATTCTGCAACCAAAGGGCAGTCAAATGCACGAAGACCAC
                      ____________________________________________________________
consensus AGAGGGAGAAACTTGGATTGAATTCTGCAACCAAAGGGCAGTCAAATGCACGAAGACCAC
 
. : . : . : . : . : . :
rJMSF044N04+ TCCCTGAACCAACTAATGCATTGCAGAAAGTTGAGGTGGAAAAGGCAAAGCAAGATGATG
                      ____________________________________________________________
consensus TCCCTGAACCAACTAATGCATTGCAGAAAGTTGAGGTGGAAAAGGCAAAGCAAGATGATG
 
. : . : . : . : . : . :
rJMSF044N04+ CCCTGTCTGATCTTAGTAATCTCTTGGGGGAGCTCAAGGAAATGGCAATGGACATGGGGT
                      ____________________________________________________________
consensus CCCTGTCTGATCTTAGTAATCTCTTGGGGGAGCTCAAGGAAATGGCAATGGACATGGGGT
 
. : . : . : . : . : . :
rJMSF044N04+ CTGAAATTGATAGGAGTAATTCGGCCTTGGATCATCTCGACAATGATATTGATGAGCTCA
                      ____________________________________________________________
consensus CTGAAATTGATAGGAGTAATTCGGCCTTGGATCATCTCGACAATGATATTGATGAGCTCA
 
. : . : . : . : . : . :
rJMSF044N04+ ACTACAGAGTGAGAGGTGCTAATATGCGAGGCCGCCATTTGCTTGGGAGGAAGTAGCATC
                      ____________________________________________________________
consensus ACTACAGAGTGAGAGGTGCTAATATGCGAGGCCGCCATTTGCTTGGGAGGAAGTAGCATC
 
. : . : . : . : . : . :
rJMSF044N04+ TGTTCAGGATCAACTTGATGACTTTTTGTTGTTCCTAAACCATGTTTGGCTCCCTTTCTA
                      ____________________________________________________________
consensus TGTTCAGGATCAACTTGATGACTTTTTGTTGTTCCTAAACCATGTTTGGCTCCCTTTCTA
 
. : . : . : . : . : . :
rJMSF044N04+ TAGTAGAGCAGAGCTTAGAGAATAACCGTTCATTCGTTGTTGGTACCATACTCCTTGATG
                      ____________________________________________________________
consensus TAGTAGAGCAGAGCTTAGAGAATAACCGTTCATTCGTTGTTGGTACCATACTCCTTGATG
 
. : . : . : . : . : . :
rJMSF044N04+ CGCATTATTGTTATTCATAGGAATTTTACTGATGTTTTTATTCATTGAACTATGAAGTGT
                      ____________________________________________________________
consensus CGCATTATTGTTATTCATAGGAATTTTACTGATGTTTTTATTCATTGAACTATGAAGTGT