Previous Contig 013567:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF028A01Sequence671019498gb:AF292397_17837711e-92Arabidopsis thaliana POZ/BTB containing-protein AtPOB1 mRNA, complete cds.708013567 (2)gb:AF292397_17837715e-78Arabidopsis thaliana POZ/BTB containing-protein AtPOB1 mRNA, complete cds.
JMSF044M22Sequence367004250 (2)734013567 (2)gb:AF292397_17837718e-78Arabidopsis thaliana POZ/BTB containing-protein AtPOB1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF028A01+ TCAAGGCTTCATATCGGCAGCGCT
rJMSF044M22+ ATATCGGCAGCGCT
                      ____________________________________________________________
consensus TCAAGGCTTCATATCGGCAGCGCT
 
. : . : . : . : . : . :
rJMSF028A01+ CGATGGCTGTTGACGAGGCTAATGTTATGTATCATCGCTTTTTGGAGCGGGCATACAAGT
rJMSF044M22+ CGATGGCTGNTGACGAGGCTAATGTTATGTATCATCGCTTTTTGGAGCGGGCATACAAGT
                      ____________________________________________________________
consensus CGATGGCTGTTGACGAGGCTAATGTTATGTATCATCGCTTTTTGGAGCGGGCATACAAGT
 
. : . : . : . : . : . :
rJMSF028A01+ ACAGGCCAGTTAAAGTTCTCGAGTTTGAATCGCCCCGTCAGCAGTGCATCGTTTACCTAG
rJMSF044M22+ ACAGGCCAGTTAAAGTTCTCGAGTTTGAATCGCCCCGTCAGCAGTGCATCGTTTACCTAG
                      ____________________________________________________________
consensus ACAGGCCAGTTAAAGTTCTCGAGTTTGAATCGCCCCGTCAGCAGTGCATCGTTTACCTAG
 
. : . : . : . : . : . :
rJMSF028A01+ ATTTAAAACGAGAGGAATGCTCGAATCTCTTTCCTGCTGGTAGAGTGTATTCACAGGCTT
rJMSF044M22+ ATTTAAAACGAGAGGAATGCTCGAATCTCTTTCCTGCTGGTAGAGTGTATTCACAGGCTT
                      ____________________________________________________________
consensus ATTTAAAACGAGAGGAATGCTCGAATCTCTTTCCTGCTGGTAGAGTGTATTCACAGGCTT
 
. : . : . : . : . : . :
rJMSF028A01+ TTCATTTAGGCGGACAGGGCTTCTTCCTCTCGGCCCACTGCAACATGGATCAACAAAACT
rJMSF044M22+ TTCATTTAGGCGGACAGGGCTTCTTCCTCTCGGCCCACTGCAACATGGATCAACAAAACT
                      ____________________________________________________________
consensus TTCATTTAGGCGGACAGGGCTTCTTCCTCTCGGCCCACTGCAACATGGATCAACAAAACT
 
. : . : . : . : . : . :
rJMSF028A01+ CGTTCCACTGCTTCGGGCTCTTCTTAGGCATGCAAGAGAAAGGATCGGTTTCATTTGCGG
rJMSF044M22+ CGTTCCACTGCTTCGGGCTCTTCTTAGGCATGCAAGAGAAAGGATCGGTTTCATTTGCGG
                      ____________________________________________________________
consensus CGTTCCACTGCTTCGGGCTCTTCTTAGGCATGCAAGAGAAAGGATCGGTTTCATTTGCGG
 
. : . : . : . : . : . :
rJMSF028A01+ TCGAGTATGAATTCGCAGCAAGGACGAAGCCAGGGGAGGAGTACGTCGGCAAGTATAAAG
rJMSF044M22+ TCGAGTATGAATTCGCAGCAAGGACGAAGCCAGGGGAGGAGTACGTCGGCAAGTATAAAG
                      ____________________________________________________________
consensus TCGAGTATGAATTCGCAGCAAGGACGAAGCCAGGGGAGGAGTACGTCGGCAAGTATAAAG
 
. : . : . : . : . : . :
rJMSF028A01+ GCAACTACAAATTCACCGGTGGGAAGGCCGTTGGGTACAGGAACCTGTTTAGTATACCTT
rJMSF044M22+ GCAACTACAAATTCACCGGTGGGAAGGCCGTTGGGTACAGGAACCTGTTTAGTATACCTT
                      ____________________________________________________________
consensus GCAACTACAAATTCACCGGTGGGAAGGCCGTTGGGTACAGGAACCTGTTTAGTATACCTT
 
. : . : . : . : . : . :
rJMSF028A01+ GGCCCGCATTTATAGCCGACGATAGCATTTACTTCATCAATGGAGTTCTCCACCTTCGAG
rJMSF044M22+ GGCCCGCATTTATAGCCGACGATAGCATTTACTTCATCAATGGAGTTCTCCACCTTCGAG
                      ____________________________________________________________
consensus GGCCCGCATTTATAGCCGACGATAGCATTTACTTCATCAATGGAGTTCTCCACCTTCGAG
 
. : . : . : . : . : . :
rJMSF028A01+ CTGAGCTAACTATCCGGCCCAACGATCTACTCGGAGACTAACAAAATGAATCGTCTGACT
rJMSF044M22+ CTGAGCTAACTATCCGGCCCAACGATCTACTCGGAGACTAACAAAATGAATCGTCTGACT
                      ____________________________________________________________
consensus CTGAGCTAACTATCCGGCCCAACGATCTACTCGGAGACTAACAAAATGAATCGTCTGACT
 
. : . : . : . : . : . :
rJMSF028A01+ GCTGTAATTTCTTTCCTTCTTCTATTGACTTAAGCACAGGACCCCGCAGAGCTTTACATA
rJMSF044M22+ GCTGTAATTTCTTTCCTTCTTCTATTGACTTAAGCACAGGACCCCGCAGAGCTTTACATA
                      ____________________________________________________________
consensus GCTGTAATTTCTTTCCTTCTTCTATTGACTTAAGCACAGGACCCCGCAGAGCTTTACATA
 
. : . : . : . : . : . :
rJMSF028A01+ TATGAGCTCTAATGGTGACTTTTAAAAAGCCATAAAGCTAAAAACTTTCCTTAGGATTTT
rJMSF044M22+ TATGAGCTCTAATGGTGACTTTTAAAAAGCCATAAAGCTAAAAACTTTCCTTAGGATTTT
                      ____________________________________________________________
consensus TATGAGCTCTAATGGTGACTTTTAAAAAGCCATAAAGCTAAAAACTTTCCTTAGGATTTT
 
. : . : . : . : . : . :
rJMSF028A01+ TAGGTTATACAGTGA-CTGGTTGAT
rJMSF044M22+ TAGGTTATACAGTGAGCTGGTTGATGTACATCCTGCTATTATCAAATGTATGCTATGCTA
                      ____________________________________________________________
consensus TAGGTTATACAGTGAGCTGGTTGATGTACATCCTGCTATTATCAAATGTATGCTATGCTA