Previous Contig 013560:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF013E18Sequence441005391 (2)743013560 (2)gb:AC115599_12058240.021Dictyostelium discoideum chromosome 2 map 4229098-4354721 strain AX4, complete s
JMSF044L10Sequence809005391 (2)gb:AY140009_15824500.006Arabidopsis thaliana expressed protein (At3g26000) mRNA, complete cds.746013560 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF013E18+ CNATTGTCAATTTTGATGCTTNTTCTGGTCANGGAAACTGGATGAATGGAG
                      ____________________________________________________________
consensus CNATTGTCAATTTTGATGCTTNTTCTGGTCANGGAAACTGGATGAATGGAG
 
. : . : . : . : . : . :
rJMSF013E18+ GCTGCATAGATCTGGCTATACAATGTTCTATGGACTATGGGGANCTTTAAACTTTTAGGA
rJMSF044L10+ CTATGGGGAACTTTAAACTTTTAGGA
                      ____________________________________________________________
consensus GCTGCATAGATCTGGCTATACAATGTTCTATGGACTATGGGGAACTTTAAACTTTTAGGA
 
. : . : . : . : . : . :
rJMSF013E18+ CGGGCTAGATTGAAGCCANTGGATTTTGCCTATTATGGGCGCTTGAGAGCATAGAGCTGG
rJMSF044L10+ CGGGCTAGATNGAAGCCANTGGATTTTGCCTATTATGGGCGCTTGAGAGCATAGAGCTGG
                      ____________________________________________________________
consensus CGGGCTAGATTGAAGCCANTGGATTTTGCCTATTATGGGCGCTTGAGAGCATAGAGCTGG
 
. : . : . : . : . : . :
rJMSF013E18+ AGGGAAAGAAATAAAAGAAAAGCTATTCTGATTGCCAGCTGCATTTTGATAAACTTATCT
rJMSF044L10+ AGGGAAAGAAATAAAAGAAAAGCTATTCTGATTGCCAGCTGCATTTTGATAAACTTATCT
                      ____________________________________________________________
consensus AGGGAAAGAAATAAAAGAAAAGCTATTCTGATTGCCAGCTGCATTTTGATAAACTTATCT
 
. : . : . : . : . : . :
rJMSF013E18+ TAAAGAGGGGAGCAAACGCGTGCATTACAAGTAGTGAACTGCTGAAAAACTAGCTCGATG
rJMSF044L10+ TAAAGAGGGGAGCAAACGCGTGCATTACAAGTAGTGAACTGCTGAAAAACTAGCTCGATG
                      ____________________________________________________________
consensus TAAAGAGGGGAGCAAACGCGTGCATTACAAGTAGTGAACTGCTGAAAAACTAGCTCGATG
 
. : . : . : . : . : . :
rJMSF013E18+ GGTTTCACGAAGATGGGACAGGAATTGCGTTTAGACTTGCATCCTACACCACTGCTAGAG
rJMSF044L10+ GGTTTCACGAAGATGGGACAGGAATTGCGTTTAGACTTGCATCCTACACCACTGCTAGAG
                      ____________________________________________________________
consensus GGTTTCACGAAGATGGGACAGGAATTGCGTTTAGACTTGCATCCTACACCACTGCTAGAG
 
. : . : . : . : . : . :
rJMSF013E18+ CATGATTAGACAAATAGTTGGCAGGTTTGTGAAAGCCAAGCATCCTTTTCTGTTATAAAC
rJMSF044L10+ CATGATTAGACAAATAGTTGGCAGGTTTGTGAAAGCCAAGCATCCTTTTCTGTTATAAAC
                      ____________________________________________________________
consensus CATGATTAGACAAATAGTTGGCAGGTTTGTGAAAGCCAAGCATCCTTTTCTGTTATAAAC
 
. : . : . : . : . : . :
rJMSF013E18+ TCCGAGAGAGAGAGAGAGAGAGAGAGAGACACATATAGCTGAGCTGTGATTGTGGTCGAC
rJMSF044L10+ TCCGAGAGAGAGAGAGAGAGAGAGAGAGACACATATAGCTGAGCTGTGATTGTGGTCGAC
                      ____________________________________________________________
consensus TCCGAGAGAGAGAGAGAGAGAGAGAGAGACACATATAGCTGAGCTGTGATTGTGGTCGAC
 
. : . : . : . : . : . :
rJMSF013E18+ GGAGAAGCTAAACATCATCGTCAGACAAGCTGGATTCTCACACACAGTGGTGACACAGGG
rJMSF044L10+ GGAGAAGCTAAACATCATCGTCAGACAAGCTGGATTCTCACACACAGTGGTGACACAGGG
                      ____________________________________________________________
consensus GGAGAAGCTAAACATCATCGTCAGACAAGCTGGATTCTCACACACAGTGGTGACACAGGG
 
. : . : . : . : . : . :
rJMSF013E18+ ATCACAATTGGAAGCTTGGAGTTGGCTCATGTGTTTAACTAAAAATGTTTTGTAATTGTA
rJMSF044L10+ ATCACAATTGGAAGCTTGGAGTTGGCTCATGTGTTTAACTAAAAATGTTTTGTAATTGTA
                      ____________________________________________________________
consensus ATCACAATTGGAAGCTTGGAGTTGGCTCATGTGTTTAACTAAAAATGTTTTGTAATTGTA
 
. : . : . : . : . : . :
rJMSF013E18+ TGTTCAATACTCAAACTCTGCTAGTGGCTATCCTCTGAATGTGTTGTCTGCCAGTTACCA
rJMSF044L10+ TGTTCAATACTCAAACTCTGCTAGTGGCTATCCTCTGAATGTGTTGTCTGCCAGTTACCA
                      ____________________________________________________________
consensus TGTTCAATACTCAAACTCTGCTAGTGGCTATCCTCTGAATGTGTTGTCTGCCAGTTACCA
 
. : . : . : . : . : . :
rJMSF013E18+ TCTGTTTGTGGTACTACTTACTACTACTAGGCATGGATTTCTTGTGACAATAACTTATGG
rJMSF044L10+ TCTGTTTGTGGTACTACTTACTACTACTAGGCATGGATTTCTTGTGACAATAACTTATGG
                      ____________________________________________________________
consensus TCTGTTTGTGGTACTACTTACTACTACTAGGCATGGATTTCTTGTGACAATAACTTATGG
 
. : . : . : . : . : . :
rJMSF013E18+ TTGTGGTAGTTATACAGTCCCAACTCATT
rJMSF044L10+ TTGTGGTAGTTATACAGTCCCAACTCATTTCCTTTGACTCTGCTTTTTCAATTCACAAAT
                      ____________________________________________________________
consensus TTGTGGTAGTTATACAGTCCCAACTCATTTCCTTTGACTCTGCTTTTTCAATTCACAAAT
 
. : . : . : . : . : . :
rJMSF044L10+ GTATTTCATCTTTTATCTGCAATGTTATTGACTTATTGGTATATAAAAGTAGCAAAGCCG
                      ____________________________________________________________
consensus GTATTTCATCTTTTATCTGCAATGTTATTGACTTATTGGTATATAAAAGTAGCAAAGCCG