Previous Contig 013558:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF044L01Sequence747013558 (2)pir|C86408|C864088e-58F3H9.12 protein - Arabidopsis thaliana>gb:AE005172_891705 Arabidopsis thaliana c762013558 (2)pir|C86408|C864083e-56F3H9.12 protein - Arabidopsis thaliana>gb:AE005172_891705 Arabidopsis thaliana c

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044L01- GGACTTCCGAGNTGAGATCTGAAAGCATTGAAAATGGA
                      ____________________________________________________________
consensus GGACTTCCGAGNTGAGATCTGAAAGCATTGAAAATGGA
 
. : . : . : . : . : . :
JMSF044L01- GGGCCAAACGAGAACAACAATGAGGAGAATCCTCCTTTTCTTGTCCTGTATAATCTTATC
                      ____________________________________________________________
consensus GGGCCAAACGAGAACAACAATGAGGAGAATCCTCCTTTTCTTGTCCTGTATAATCTTATC
 
. : . : . : . : . : . :
JMSF044L01- CATCGGAAACTGCGGCGGCCCTTTGCTCATACGCCTCTACTTCCTCCGAGGCGGCAACCG
                      ____________________________________________________________
consensus CATCGGAAACTGCGGCGGCCCTTTGCTCATACGCCTCTACTTCCTCCGAGGCGGCAACCG
 
. : . : . : . : . : . :
JMSF044L01- GATATGGTTTTCCAGCTGGCTACAAACCGCCGGCTTCCCGGTCATTTTCATCCCGCTTCT
                      ____________________________________________________________
consensus GATATGGTTTTCCAGCTGGCTACAAACCGCCGGCTTCCCGGTCATTTTCATCCCGCTTCT
 
. : . : . : . : . : . :
JMSF044L01- CGTATCTTATCACCGCCGCCGGCGAGCTTGTAGCGATGAAAGCTCCAAAAGCAGGAAGTT
                      ____________________________________________________________
consensus CGTATCTTATCACCGCCGCCGGCGAGCTTGTAGCGATGAAAGCTCCAAAAGCAGGAAGTT
 
. : . : . : . : . : . :
JMSF044L01- CTTCCTAATCACACCGTTTTTGTCCATCGCCGCCGCACTACTCGGCGTTCTCGTAGGCGT
                      ____________________________________________________________
consensus CTTCCTAATCACACCGTTTTTGTCCATCGCCGCCGCACTACTCGGCGTTCTCGTAGGCGT
 
. : . : . : . : . : . :
JMSF044L01- GGACAACTATTTCTACTCCTACGGCATGGCAAAGCTTCCTGTGTCGACCTCGTCTCTCAT
                      ____________________________________________________________
consensus GGACAACTATTTCTACTCCTACGGCATGGCAAAGCTTCCTGTGTCGACCTCGTCTCTCAT
 
. : . : . : . : . : . :
JMSF044L01- CGTAGCCACCCAGCTGGTCTTCACGGCCGGATTCGCTTTCCTCCTCGTGAAGCAAAAGTT
rJMSF044L01+ CTTCACGGCCGGATTCGCTTTCCTCCTCGTGAAGCAAAAGTT
                      ____________________________________________________________
consensus CGTAGCCACCCAGCTGGTCTTCACGGCCGGATTCGCTTTCCTCCTCGTGAAGCAAAAGTT
 
. : . : . : . : . : . :
JMSF044L01- CACGGCGTTTTCGACAAACGCCGTGGTATTATTGACAGTCGGGGCGGTGGTGTTGGGGCT
rJMSF044L01+ CACGGCGTTTTCGACAAACGCCGTGGTATTATTGACAGTCGGGGCGGTGGTGTTGGGGCT
                      ____________________________________________________________
consensus CACGGCGTTTTCGACAAACGCCGTGGTATTATTGACAGTCGGGGCGGTGGTGTTGGGGCT
 
. : . : . : . : . : . :
JMSF044L01- CCGAGCCGGAAGTGACCGCCCGGCTGGAGAGTCAAACAAGGCCTATCTTTTAGGGTTCGT
rJMSF044L01+ CCGAGCCGGAAGTGACCGCCCGGCTGGAGAGTCAAACAAGGCCTATCTTTTAGGGTTCGT
                      ____________________________________________________________
consensus CCGAGCCGGAAGTGACCGCCCGGCTGGAGAGTCAAACAAGGCCTATCTTTTAGGGTTCGT
 
. : . : . : . : . : . :
JMSF044L01- GATGACTGTGGCTGCGGCGGCGTTGTATGGGTTGATTCTGCCATTGATAGAGCTGAGTTA
rJMSF044L01+ GATGACTGTGGCTGCGGCGGCGTTGTATGGGTTGATTCTGCCATTGATAGAGCTGAGTTA
                      ____________________________________________________________
consensus GATGACTGTGGCTGCGGCGGCGTTGTATGGGTTGATTCTGCCATTGATAGAGCTGAGTTA
 
. : . : . : . : . : . :
JMSF044L01- TTTGAAGGCCAAGCTGCAGGCAGTTAGCTTTAGTTTAGTGTTGGAATTTCAGATGATTAT
rJMSF044L01+ TTTGAAGGCCAAGCTGCAGGCAGTTAGCTTTAGTTTAGTGTTGGAATTTCAGATGATTAT
                      ____________________________________________________________
consensus TTTGAAGGCCAAGCTGCAGGCAGTTAGCTTTAGTTTAGTGTTGGAATTTCAGATGATTAT
 
. : . : . : . : . : . :
JMSF044L01- GGGTTTTGTCGGTACTATTTTCTCCACTGTCGGAATGGTCATAAACAAG
rJMSF044L01+ GGGTTTTGTCGGTACTATTTTCTCCACTGTCGGAATGGTCATAAACAAGGATTTTGAGGT
                      ____________________________________________________________
consensus GGGTTTTGTCGGTACTATTTTCTCCACTGTCGGAATGGTCATAAACAAGGATTTTGAGGT
 
. : . : . : . : . : . :
rJMSF044L01+ AATTCCAAGGGAGGCAAGGGAATTTGAACTGGGAGTAACAAAATACTACGTATTAGCCGT
                      ____________________________________________________________
consensus AATTCCAAGGGAGGCAAGGGAATTTGAACTGGGAGTAACAAAATACTACGTATTAGCCGT
 
. : . : . : . : . : . :
rJMSF044L01+ ATTTACTGCGATTGTATGGCAATTCTTCTTTGTGGGAGCTCTTGGAGTCATCTCCTACGG
                      ____________________________________________________________
consensus ATTTACTGCGATTGTATGGCAATTCTTCTTTGTGGGAGCTCTTGGAGTCATCTCCTACGG
 
. : . : . : . : . : . :
rJMSF044L01+ TTCATCATTGCTCTCAGCTCTCATAGTCGCGGTTCTGCTCCCCGTAACGGAGATCTTGGC
                      ____________________________________________________________
consensus TTCATCATTGCTCTCAGCTCTCATAGTCGCGGTTCTGCTCCCCGTAACGGAGATCTTGGC
 
. : . : . : . : . : . :
rJMSF044L01+ CGTCATCTTCTACCATGAGAAGTTCGAAGCCGAGAAAGGCATCTCTCTGTTCCTCTCAAT
                      ____________________________________________________________
consensus CGTCATCTTCTACCATGAGAAGTTCGAAGCCGAGAAAGGCATCTCTCTGTTCCTCTCAAT
 
. : . : . : . : . : . :
rJMSF044L01+ CTGGGGATTTGTTTCTTATTTTTACGGCGATATTAAGAATACCAAAAAAGATAATAATGA
                      ____________________________________________________________
consensus CTGGGGATTTGTTTCTTATTTTTACGGCGATATTAAGAATACCAAAAAAGATAATAATGA
 
. : . : . : . : . : . :
rJMSF044L01+ ATCATCTGCAGAAACAGAGATGACCAGTGCTCCAACCGTTGCTTCCACGCAAGCAGTATA
                      ____________________________________________________________
consensus ATCATCTGCAGAAACAGAGATGACCAGTGCTCCAACCGTTGCTTCCACGCAAGCAGTATA
 
. : . : . : . : . : . :
rJMSF044L01+ AAAGAACCTAAGCTATCCTAGCTTCTTTTCATATGTATGAAAATATATGTATGTGCGTGC
                      ____________________________________________________________
consensus AAAGAACCTAAGCTATCCTAGCTTCTTTTCATATGTATGAAAATATATGTATGTGCGTGC