Previous Contig 013554:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF025E17Sequence642006281 (3)gb:AF268257_17820362e-31Arabidopsis thaliana PTEN-like protein mRNA, complete cds.704013554 (3)gb:AF268257_17820362e-15Arabidopsis thaliana PTEN-like protein mRNA, complete cds.
JMSF031H10Sequence634013554 (3)gb:AF268257_17820367e-11Arabidopsis thaliana PTEN-like protein mRNA, complete cds.
JMSF044J14Sequence814006281 (3)gb:AF268257_17820362e-60Arabidopsis thaliana PTEN-like protein mRNA, complete cds.761013554 (3)gb:AF268257_17820369e-22Arabidopsis thaliana PTEN-like protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044J14+ TGAATACGGCCGACCTTGATGGTTTCGACAAGAGAAAAACTGC
                      ____________________________________________________________
consensus TGAATACGGCCGACCTTGATGGTTTCGACAAGAGAAAAACTGC
 
. : . : . : . : . : . :
rJMSF025E17+ CCTAGTGGAAGCTGTACTTGCGGACTATGATGCTGCTTTTCCCGCAA
rJMSF044J14+ CCTCGCCTGGTTTCCTAGTGGAAGCTGTACTTGCGGACTATGATGCTGCTTTTCCCGCAA
                      ____________________________________________________________
consensus CCTCGCCTGGTTTCCTAGTGGAAGCTGTACTTGCGGACTATGATGCTGCTTTTCCCGCAA
 
. : . : . : . : . : . :
rJMSF025E17+ CTCCTCAACCAGAAGCTACTGGTGTAAAATCAGCTGACAATTCGAGTCCCAAAACTACCT
rJMSF031H10+ ACCAGAAGCTANTGGTGTAAAATCAGCTGACAATTCGAGTCCCAAAACTACCT
rJMSF044J14+ CTCCTCAACCAGAAGCTACTGGTGTAAAATCAGCTGACAATTCGAGTCCCAAAACTACCT
                      ____________________________________________________________
consensus CTCCTCAACCAGAAGCTACTGGTGTAAAATCAGCTGACAATTCGAGTCCCAAAACTACCT
 
. : . : . : . : . : . :
rJMSF025E17+ CTTTTCCCAGTCCGGGCTCAGCTGATGAGTCTGCAGCCGCTGCTGTTGACTCAAACCAAC
rJMSF031H10+ CTTTTCCCAGTCCGGGCTCAGCTGATGAGTCTGCAGCCGCTGCTGTTGACTCAAACCAAC
rJMSF044J14+ CTTTTCCCAGTCCGGGCTCAGCTGATGAGTCTGCAGCCGCTGCTGTTGACTCAAACCAAC
                      ____________________________________________________________
consensus CTTTTCCCAGTCCGGGCTCAGCTGATGAGTCTGCAGCCGCTGCTGTTGACTCAAACCAAC
 
. : . : . : . : . : . :
rJMSF025E17+ AATCAGCTAGCAACAAGAAAGACGATGTATTTTCTGACAATGAGGCTGAAGAAAGCGGGA
rJMSF031H10+ AATCAGCTAGCAACAAGAAAGACGATGTATTTTCTGACAATGAGGCTGAAGAAAGCGGGA
rJMSF044J14+ AATCAGCTAGCAACAAGAAAGACGATGTATTTTCTGACAATGAGGCTGAAGAAAGCGGGA
                      ____________________________________________________________
consensus AATCAGCTAGCAACAAGAAAGACGATGTATTTTCTGACAATGAGGCTGAAGAAAGCGGGA
 
. : . : . : . : . : . :
rJMSF025E17+ AAAGGAAAGTTACAGCCGCTTCTGAAGGTGTAGACGCTGAAGTCTCGGGTTTTGGGACTA
rJMSF031H10+ AAAGGAAAGTTACAGCCGCTTCTGAAGGTGTAGACGNTGAAGTCTCGGGTTCTGGGANTA
rJMSF044J14+ AAAGGAAAGTTACAGCCGCTTCTGAAGGTGTAGACGCTGAAGTCTCGGGTTCTGGGACTA
                      ____________________________________________________________
consensus AAAGGAAAGTTACAGCCGCTTCTGAAGGTGTAGACGCTGAAGTCTCGGGTTCTGGGACTA
 
. : . : . : . : . : . :
rJMSF025E17+ ATACTGGTTCAACTCAAATCTCGAGTTTGACACACAAGGCGGAGCAAATCTCACTGCAAG
rJMSF031H10+ ATNTTGGTTCAACTCNAATCTCGAGTNTGACACACAAGGCGGAGCAAATCTCACTGCAAG
rJMSF044J14+ ATACTGGTTCAACTCAAATCTCGAGTTTGACACACAAGGCGGAGCAAATCTCACTGCAAG
                      ____________________________________________________________
consensus ATACTGGTTCAACTCAAATCTCGAGTTTGACACACAAGGCGGAGCAAATCTCACTGCAAG
 
. : . : . : . : . : . :
rJMSF025E17+ ATCCCGGGGCTAAACACAACGAGCCAAAAAAGGATGCCGCTGTTGGAGCTGCACCAGGCG
rJMSF031H10+ ATCCCGGGNCTAAACACANCGAGCCAAAAAAGGATGCCGCTGTNGGAGCTGCACCAGGCG
rJMSF044J14+ ATCCCGGGGCTAAACACAACGAGCCAAAAAAGGATGCCGCTGTTGGAGCTGCACCAGGCG
                      ____________________________________________________________
consensus ATCCCGGGGCTAAACACAACGAGCCAAAAAAGGATGCCGCTGTTGGAGCTGCACCAGGCG
 
. : . : . : . : . : . :
rJMSF025E17+ GTGACACCCCTAGTTTAGCAGAAGTGAGCGATTTCAAAGCCATGGCTGCTGATGCATCTG
rJMSF031H10+ GTGACACCCCTAGTTTAGCAGAAGTGAGCGATTTCAAAGCCATGGCTGCTGATGCATCTG
rJMSF044J14+ GTGACACCCCTAGTTTAGCAGAAGTGAGCGATTTCAAAGCCATGGCTGCTGATGCATCTG
                      ____________________________________________________________
consensus GTGACACCCCTAGTTTAGCAGAAGTGAGCGATTTCAAAGCCATGGCTGCTGATGCATCTG
 
. : . : . : . : . : . :
rJMSF025E17+ TGTTTACATTTGGAGATGAAGAGGATTATGAAAGTGAATGAATAAAATGGCCCCCACATA
rJMSF031H10+ TGTTTNCATTTGGAGATGAAGAGGATTATGAAAGTGAATGAATAAAATGGCCCCCACATA
rJMSF044J14+ TGTTTACATTTGGAGATGAAGAGGATTATGAAAGTGAATGAATAAAATGGCCCCCACATA
                      ____________________________________________________________
consensus TGTTTACATTTGGAGATGAAGAGGATTATGAAAGTGAATGAATAAAATGGCCCCCACATA
 
. : . : . : . : . : . :
rJMSF025E17+ TACGAAACTATGTACAGAAATAGCGCAGCTCACACATGGTTTGTTATTGGTTTAATCTGA
rJMSF031H10+ TACGAAACTATGTACAGAAATAGCGCAGCTCACACATGGTTTGTTATTGGTTTAATCTGA
rJMSF044J14+ TACGAAACTATGTACAGAAATAGCGCAGCTCACACATGGTTTGTTATTGGTTTAATCTGA
                      ____________________________________________________________
consensus TACGAAACTATGTACAGAAATAGCGCAGCTCACACATGGTTTGTTATTGGTTTAATCTGA
 
. : . : . : . : . : . :
rJMSF025E17+ TGGAACAACAAATCCGGTTTCATTCATCGTATTCAAATGTATGATTGTTGGACCATTTCT
rJMSF031H10+ TGGAACAACAAATCCGGTTTCATTCATCGTATTCAAATGTATGATTGTTGGACCATTTCT
rJMSF044J14+ TGGAACAACAAATCCGGTTTCATTCATCGTATTCAAATGTATGATTGTTGGACCATTTCT
                      ____________________________________________________________
consensus TGGAACAACAAATCCGGTTTCATTCATCGTATTCAAATGTATGATTGTTGGACCATTTCT
 
. : . : . : . : . : . :
rJMSF025E17+ TT-CCTGTATTATTGTCTGTCCAGA-ACTGAGTATGAGGATTGCCATGGAC
rJMSF031H10+ TTCCCTGTATNATTGTCTGTCCAGACACTGAGTATGAGGAT
rJMSF044J14+ TT-CCTGTATTATTGTCTGTCCAGA-ACTGAGTATGAGGATTGCCATGGACCTGAAGAAT
                      ____________________________________________________________
consensus TT-CCTGTATTATTGTCTGTCCAGA-ACTGAGTATGAGGATTGCCATGGACCTGAAGAAT