Previous Contig 013553:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021H21Sequence665005988 (2)pir|T47587|T475873e-37TATA box binding protein (TBP) associated factor (TAF)-like protein - Arabidopsi803013553 (2)pir|T47587|T475875e-44TATA box binding protein (TBP) associated factor (TAF)-like protein - Arabidopsi
JMSF044I22Sequence764005988 (2)pir|T47587|T475874e-39TATA box binding protein (TBP) associated factor (TAF)-like protein - Arabidopsi706013553 (2)pir|T47587|T475872e-42TATA box binding protein (TBP) associated factor (TAF)-like protein - Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021H21+ AAAGGGTGGTCCAAGGATGGAGANCCAGAT
                      ____________________________________________________________
consensus AAAGGGTGGTCCAAGGATGGAGANCCAGAT
 
. : . : . : . : . : . :
rJMSF021H21+ GCTCCCCNACCACAAGATATGACTTCACCGAGGGGCATCCAATCTGATGCATCGGGCTCT
                      ____________________________________________________________
consensus GCTCCCCNACCACAAGATATGACTTCACCGAGGGGCATCCAATCTGATGCATCGGGCTCT
 
. : . : . : . : . : . :
rJMSF021H21+ AATAAGATGCATCTGGATACTGTGTCTGATGAAGATGGTTTAGAGAGTGATGGAGATGGG
rJMSF044I22+ GGATACTGTGTCTGATGAAGATGGTTTAGAGAGTGATGGAGATGGG
                      ____________________________________________________________
consensus AATAAGATGCATCTGGATACTGTGTCTGATGAAGATGGTTTAGAGAGTGATGGAGATGGG
 
. : . : . : . : . : . :
rJMSF021H21+ TGTTGGCCCTTTCAAAGTTTTGTTGAACAACTCATGGTTGATATGTTTGATCCTTTATGG
rJMSF044I22+ TGTTGGCCCTTTCAAAGTTTTGTTGAACAACTCATGGTTGATATGTTTGATCCTTTATGG
                      ____________________________________________________________
consensus TGTTGGCCCTTTCAAAGTTTTGTTGAACAACTCATGGTTGATATGTTTGATCCTTTATGG
 
. : . : . : . : . : . :
rJMSF021H21+ GAGATTCGTCATGGCAGTGTCATGGCATTAAGAGAGATATTAACCCATCAAGGTGCAAAT
rJMSF044I22+ GAGATTCGTCATGGCAGTGTCATGGCATTAAGAGAGATATTAACCCATCAAGGTGCAAAT
                      ____________________________________________________________
consensus GAGATTCGTCATGGCAGTGTCATGGCATTAAGAGAGATATTAACCCATCAAGGTGCAAAT
 
. : . : . : . : . : . :
rJMSF021H21+ GCTGGAGCTATTATGCCTGATCGCAGCCTTGATGTTGGATTAGGTTCTATTTTAAAAGAC
rJMSF044I22+ GCTGGAGCTATTATGCCTGATCGCAGCCTTGATGTTGGATTAGGTTCTATTTTAAAAGAC
                      ____________________________________________________________
consensus GCTGGAGCTATTATGCCTGATCGCAGCCTTGATGTTGGATTAGGTTCTATTTTAAAAGAC
 
. : . : . : . : . : . :
rJMSF021H21+ AGGGTTGTTGAAAAGCAGGAAAGTGTAATTGATTTGAATATACAAGTTCCAGTTGATGAG
rJMSF044I22+ AGGGTTGTTGAAAAGCAGGAAAGTGTAATTGATTTGAATATACAAGTTCCAGTTGATGAG
                      ____________________________________________________________
consensus AGGGTTGTTGAAAAGCAGGAAAGTGTAATTGATTTGAATATACAAGTTCCAGTTGATGAG
 
. : . : . : . : . : . :
rJMSF021H21+ TCTGAGCCAGCTTTTAAGAAGCCTAAGATTGAAGATGCATCACCTCTTCTGATGGATACA
rJMSF044I22+ TCTGAGCCAGCTTTTAAGAAGCCTAAGATTGAAGATGCATCACCTCTTCTGATGGATACA
                      ____________________________________________________________
consensus TCTGAGCCAGCTTTTAAGAAGCCTAAGATTGAAGATGCATCACCTCTTCTGATGGATACA
 
. : . : . : . : . : . :
rJMSF021H21+ ATTCCTTCTGCCAGCATGGTTGGTAACATTGACAATATTCAAGTGAAAGTCGAAGATGTT
rJMSF044I22+ ATTCCTTCTGCCAGCATGGTTGGTAACATTGACAATATTCAAGTGAAAGTCGAAGATGTT
                      ____________________________________________________________
consensus ATTCCTTCTGCCAGCATGGTTGGTAACATTGACAATATTCAAGTGAAAGTCGAAGATGTT
 
. : . : . : . : . : . :
rJMSF021H21+ GGATTGAATTTGCCAGTAAAGCAGGAAAATGGTGAATTTAATGTTGGCTCTCTGAAGATG
rJMSF044I22+ GGATTGAATTTGCCAGTAAAGCAGGAAAATGGTGAATTTAATGTTGGCTCTCTGAAGATG
                      ____________________________________________________________
consensus GGATTGAATTTGCCAGTAAAGCAGGAAAATGGTGAATTTAATGTTGGCTCTCTGAAGATG
 
. : . : . : . : . : . :
rJMSF021H21+ GAGATTCAGTCTAATTCCAATAGTGAAAGTTCTTTCAATAATGATATGGTAGAGGCAAAG
rJMSF044I22+ GAGATTCAGTCTAATTCCAATAGTGAAAGTTCTTTCAATAATGATATGGTAGAGGCAAAG
                      ____________________________________________________________
consensus GAGATTCAGTCTAATTCCAATAGTGAAAGTTCTTTCAATAATGATATGGTAGAGGCAAAG
 
. : . : . : . : . : . :
rJMSF021H21+ AGCTCCTGTGAGGACAATATCTCCTTAGAAAAGATGGATCTACCAAGAAATCTTCCAGAA
rJMSF044I22+ AGCTCCTGTGAGGACAATATCTCCTTAGAAAAGATGGATCTACCAAGAAATCTTCCAGAA
                      ____________________________________________________________
consensus AGCTCCTGTGAGGACAATATCTCCTTAGAAAAGATGGATCTACCAAGAAATCTTCCAGAA
 
. : . : . : . : . : . :
rJMSF021H21+ AATTGTGAGCTGATGAACTTGGTTAAATTGGCTAGGCATTCTTGGCTTAAAAATTCTGAA
rJMSF044I22+ AATTGTGAGCTGATGAACTTGGTTAAATTGGCTAGGCATTCTTGGCTTAAAAATTCTGAA
                      ____________________________________________________________
consensus AATTGTGAGCTGATGAACTTGGTTAAATTGGCTAGGCATTCTTGGCTTAAAAATTCTGAA
 
. : . : . : . : . : . :
rJMSF021H21+ TTTCTTCAAGACTGTGCAATTCGTTTCTTGTGTATATTGT-CACTGGACCGGTA
rJMSF044I22+ TTTCTTCAAGACTGTGCAATTCGTTTCTTGTGTATATTGTCCACTGGACCGGTATGAAAT
                      ____________________________________________________________
consensus TTTCTTCAAGACTGTGCAATTCGTTTCTTGTGTATATTGTCCACTGGACCGGTATGAAAT