Previous Contig 013552:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF005F14Sequence408013552 (3)514012399 (3)pir|T47663|T476632e-08hypothetical protein T26I12.120 - Arabidopsis thaliana>gb:ATT26I12_1555481 Arabi
JMSF044I05Sequence814013552 (3)788013552 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044I05- GGCATTTC
                      ____________________________________________________________
consensus GGCATTTC
 
. : . : . : . : . : . :
JMSF044I05- ATTTCACTCTGAACCTCTCTAGCTCTTTACACGATGAAGAACTTCCTCTATCTCTCTAAA
                      ____________________________________________________________
consensus ATTTCACTCTGAACCTCTCTAGCTCTTTACACGATGAAGAACTTCCTCTATCTCTCTAAA
 
. : . : . : . : . : . :
JMSF044I05- ATTCTCGCTCGATTTACCGTTTAATCTTACCATTCTGAGTGTATAATCAGTATATCCATT
                      ____________________________________________________________
consensus ATTCTCGCTCGATTTACCGTTTAATCTTACCATTCTGAGTGTATAATCAGTATATCCATT
 
. : . : . : . : . : . :
JMSF044I05- CCAAAATCAATACTTGATTTTGGAATAGATCTTTGAATCTGATGTCTCATAACAACACTA
                      ____________________________________________________________
consensus CCAAAATCAATACTTGATTTTGGAATAGATCTTTGAATCTGATGTCTCATAACAACACTA
 
. : . : . : . : . : . :
JMSF044I05- CTTAGCAAGGAAGGGAGTTCGCAGCACCCAGTTCCAGCATAATGTTTCGCTCCAGAATTC
                      ____________________________________________________________
consensus CTTAGCAAGGAAGGGAGTTCGCAGCACCCAGTTCCAGCATAATGTTTCGCTCCAGAATTC
 
. : . : . : . : . : . :
JMSF044I05- ATCTCACAATCAATTCAGGTTAAATGATGTTCGCAGTCCTGTACACAGTATCAGTACTGT
                      ____________________________________________________________
consensus ATCTCACAATCAATTCAGGTTAAATGATGTTCGCAGTCCTGTACACAGTATCAGTACTGT
 
. : . : . : . : . : . :
JMSF005F14+ GGATGGTGAATTTTATGTTCCAACTGAAATTGTAGGCATTGAAGGGTCT
JMSF044I05- CCTAGTCTACAGGATGGTGAATTTTATGTTCCAACTGAAATTGTAGGCATTGAAGGGTCT
                      ____________________________________________________________
consensus CCTAGTCTACAGGATGGTGAATTTTATGTTCCAACTGAAATTGTAGGCATTGAAGGGTCT
 
. : . : . : . : . : . :
JMSF005F14+ TTTGGCTGGGTGTACATCTCTTGCACGTCACCGAGATGCAACAGAAAGCTCAAGCAAGAA
JMSF044I05- TTTGGCTGGGTGTACATCTCTTGCACGTCACCGAGATGCAACAGAAAGCTCAAGCAAGAA
                      ____________________________________________________________
consensus TTTGGCTGGGTGTACATCTCTTGCACGTCACCGAGATGCAACAGAAAGCTCAAGCAAGAA
 
. : . : . : . : . : . :
JMSF005F14+ GGAGATGATCTGGTTTATTCAACTTGTGAGAAAAAAATATAAAGAAGGAATGATCAGGTA
JMSF044I05- GGAGATGATCTGGTTTATTCAACTTGTGAGAAAAAAATATAAAGAAGGAATGATCAGGTA
                      ____________________________________________________________
consensus GGAGATGATCTGGTTTATTCAACTTGTGAGAAAAAAATATAAAGAAGGAATGATCAGGTA
 
. : . : . : . : . : . :
JMSF005F14+ TAGGGTGATAGTGAGGGTTCTAGATAAATATTTATGAGATTCTCCCTTCCTTTTATGGGA
JMSF044I05- TAGGGTGATAGTGAGGGTTCTAGATAAATATTTATGAGATTCTCCCTTCCTTTTATGGGA
rJMSF044I05+ TTATGGGA
                      ____________________________________________________________
consensus TAGGGTGATAGTGAGGGTTCTAGATAAATATTTATGAGATTCTCCCTTCCTTTTATGGGA
 
. : . : . : . : . : . :
JMSF005F14+ TAGGGAGTGTTCAGATTTAGTGGGTATCCCTGCTAGCATTTTGTACAACAAGG
JMSF044I05- TAGGGAGTGTTCAGATTTAGTGGGTATCCCTGCTAGCATTTTGTACAACAAGGTAAACTT
rJMSF044I05+ TAGGGAGTGTTCAGATTTAGTGGGTATCCCTGCTAGCATTTTGTACAACAAGGTAAACTT
                      ____________________________________________________________
consensus TAGGGAGTGTTCAGATTTAGTGGGTATCCCTGCTAGCATTTTGTACAACAAGGTAAACTT
 
. : . : . : . : . : . :
JMSF044I05- ACATTCCTAAAAAATGGTAATATGATAAACTAACATTTATAAGGATTATTTTTAGTGGTT
rJMSF044I05+ ACATTCCTAAAAAATGGTAATATGATAAACTAACATTTATAAGGATTATTTTTAGTGGTT
                      ____________________________________________________________
consensus ACATTCCTAAAAAATGGTAATATGATAAACTAACATTTATAAGGATTATTTTTAGTGGTT
 
. : . : . : . : . : . :
JMSF044I05- TGTTTATAAAAAATGGATTTTGTCTTTGTTTTAGGGGTCTGATATTCCAAAAGAATTGGA
rJMSF044I05+ TGTTTATAAAAAATGGATTTTGTCTTTGTTTTAGGGGTCTGATATTCCAAAAGAATTGGA
                      ____________________________________________________________
consensus TGTTTATAAAAAATGGATTTTGTCTTTGTTTTAGGGGTCTGATATTCCAAAAGAATTGGA
 
. : . : . : . : . : . :
JMSF044I05- ATCCTTAATTGGAATGACAATGATATTTAAGATATCATTAAAAATGAACCAAATGAAGGG
rJMSF044I05+ ATCCTTAATTGGAATGACAATGATATTTAAGATATCATTAAAAATGAACCAAATGAAGGG
                      ____________________________________________________________
consensus ATCCTTAATTGGAATGACAATGATATTTAAGATATCATTAAAAATGAACCAAATGAAGGG
 
. : . : . : . : . : . :
JMSF044I05- AGCTACTCCAGCCTTTACTATTATGA
rJMSF044I05+ AGCTACTCCAGCCTTTACTATTATGAGAGTTTTGAGGGATGAACTCTTAGTCTCTACGTA
                      ____________________________________________________________
consensus AGCTACTCCAGCCTTTACTATTATGAGAGTTTTGAGGGATGAACTCTTAGTCTCTACGTA
 
. : . : . : . : . : . :
rJMSF044I05+ CGGTTCAAAATTGAAGGAGAACCAATTCCAAGAAAAAGATTTGATGCCTAAAATGATAAA
                      ____________________________________________________________
consensus CGGTTCAAAATTGAAGGAGAACCAATTCCAAGAAAAAGATTTGATGCCTAAAATGATAAA
 
. : . : . : . : . : . :
rJMSF044I05+ TGAGGATGAAGTGGAGGATGATGAATCAGATCAGGTAATTATTTATATTTCACAAAAAAA
                      ____________________________________________________________
consensus TGAGGATGAAGTGGAGGATGATGAATCAGATCAGGTAATTATTTATATTTCACAAAAAAA
 
. : . : . : . : . : . :
rJMSF044I05+ TGTCTTTAAAAAAATTTTTTGTGGTTAAAAATTAATATTTTTAAAATTAACAAGAAGCTT
                      ____________________________________________________________
consensus TGTCTTTAAAAAAATTTTTTGTGGTTAAAAATTAATATTTTTAAAATTAACAAGAAGCTT
 
. : . : . : . : . : . :
rJMSF044I05+ CTAATGGAAATGAAGTAAACAGCCTAATCAGTGCAGAATAGTCCAAAAGGCTTGACACTG
                      ____________________________________________________________
consensus CTAATGGAAATGAAGTAAACAGCCTAATCAGTGCAGAATAGTCCAAAAGGCTTGACACTG
 
. : . : . : . : . : . :
rJMSF044I05+ ACTTTGAAGACTCAAATGGTGTGAAGAAATCCCTTATGGACCAATTCTCTTCATCAAACA
                      ____________________________________________________________
consensus ACTTTGAAGACTCAAATGGTGTGAAGAAATCCCTTATGGACCAATTCTCTTCATCAAACA
 
. : . : . : . : . : . :
rJMSF044I05+ AACTTAAGAAGACAAAAATGTGACTGTTAAGCAAGAAAAAATTTAATTTCTGAGTGTATT
                      ____________________________________________________________
consensus AACTTAAGAAGACAAAAATGTGACTGTTAAGCAAGAAAAAATTTAATTTCTGAGTGTATT
 
. : . : . : . : . : . :
rJMSF044I05+ TCAGAAGTGGTCATTGGCTTGAGACAATATACCACCTTTGTGTGGTATTTTATCTTTTTT
                      ____________________________________________________________
consensus TCAGAAGTGGTCATTGGCTTGAGACAATATACCACCTTTGTGTGGTATTTTATCTTTTTT
 
. : . : . : . : . : . :
rJMSF044I05+ GTGGTCTGGTATTGGGACATTCTGAATCAATAGGCAATGTGGGCAGTGCCTATCCAAACC
                      ____________________________________________________________
consensus GTGGTCTGGTATTGGGACATTCTGAATCAATAGGCAATGTGGGCAGTGCCTATCCAAACC