Previous Contig 013543:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF044F15Sequence844013543 (4)gb:AB076984_15235396e-87Arabidopsis thaliana DNA, chromosome 1, clone:P1-C15J, partial sequence.754013543 (4)gb:AC027036_15398203e-53Arabidopsis thaliana chromosome 1 BAC T4M14 genomic sequence, complete sequence.
JMSF045F15Sequence602013543 (4)gb:AC027036_15398204e-44Arabidopsis thaliana chromosome 1 BAC T4M14 genomic sequence, complete sequence.511013543 (4)gb:AC027036_15398201e-21Arabidopsis thaliana chromosome 1 BAC T4M14 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045F15- G
JMSF044F15- GG
                      ____________________________________________________________
consensus GG
 
. : . : . : . : . : . :
JMSF045F15- CTACGTCTTCAACTTTGCATATTTGCAACTTCTCTGCACTCTATCCTTGTTAACTTCGCG
JMSF044F15- CTACGTCTTCAACTTTGCATATTTGCAACTTCTCTGCACTCTATCCTTGTTAACTTCGCG
                      ____________________________________________________________
consensus CTACGTCTTCAACTTTGCATATTTGCAACTTCTCTGCACTCTATCCTTGTTAACTTCGCG
 
. : . : . : . : . : . :
JMSF045F15- ATTTCCAAATTAGTAAAATCAGCGTCTCGATATTCATATTGATTGAGAAACTTCAGAAGC
JMSF044F15- ATTTCCAAATTAGTAAAATCAGCGTCTCGATATTCATATTGATTGAGAAACTTCAGAAGC
                      ____________________________________________________________
consensus ATTTCCAAATTAGTAAAATCAGCGTCTCGATATTCATATTGATTGAGAAACTTCAGAAGC
 
. : . : . : . : . : . :
JMSF045F15- TTTCTTCAGCAATTCCTTCTGAGAAATTCNCAACAAATCTTTATCAGGTGAAAACTAAAG
JMSF044F15- TTTCTTCAGCAATTCCTTCTGAGAAATTCGCAACAAATCTTTATCAGGTGAAAACTAAAG
                      ____________________________________________________________
consensus TTTCTTCAGCAATTCCTTCTGAGAAATTCGCAACAAATCTTTATCAGGTGAAAACTAAAG
 
. : . : . : . : . : . :
JMSF045F15- AACAACATACACAATGCTACTGGGCAACGGAGGAGGCCAAACCCCTAGTCGGTTTGAGTT
JMSF044F15- AACAACATACACAATGCTACTGGGCAACGGAGGAGGCCAAACCCCTAGTCGGTTTGAGTT
                      ____________________________________________________________
consensus AACAACATACACAATGCTACTGGGCAACGGAGGAGGCCAAACCCCTAGTCGGTTTGAGTT
 
. : . : . : . : . : . :
JMSF045F15- GTTGAGTATGGTGAAGAAGCACTCAAAATTTTTAGGGAAAACCATAGTGGAGGAGGAAGA
JMSF044F15- GTTGAGTATGGTGAAGAAGCACTCAAAATTTTTAGGGAAAACCATAGTGGAGGAGGAAGA
                      ____________________________________________________________
consensus GTTGAGTATGGTGAAGAAGCACTCAAAATTTTTAGGGAAAACCATAGTGGAGGAGGAAGA
 
. : . : . : . : . : . :
JMSF045F15- TCCATCGGATGTGGAAATGGATCCACAGTTCTGGCATGAAGTATTGGATTTGTATTTCGT
JMSF044F15- TCCATCGGATGTGGAAATGGATCCACAGTTCTGGCATGAAGTATTGGATTTGTATTTCGT
                      ____________________________________________________________
consensus TCCATCGGATGTGGAAATGGATCCACAGTTCTGGCATGAAGTATTGGATTTGTATTTCGT
 
. : . : . : . : . : . :
JMSF045F15- ATGTGGAAAGGAATCCAGAGGCCGTCAGGAGGATGATCTCATATTCTTCGTCCGAAAAAT
JMSF044F15- ATGTGGAAAGGAATCCAGAGGCCGTCAGGAGGATGATCTCATATTCTTCGTCCGAAAAAT
                      ____________________________________________________________
consensus ATGTGGAAAGGAATCCAGAGGCCGTCAGGAGGATGATCTCATATTCTTCGTCCGAAAAAT
 
. : . : . : . : . : . :
JMSF045F15- GAGTTTGCAAGGATATGAATCCAATGGCAACAGTGAAGACAATTCTCCTTACTTTGTACG
JMSF044F15- GAGTTTGCAAGGATATGAATCCAATGGCAACAGTGAAGACAATTCTCCTTACTTTGTACG
                      ____________________________________________________________
consensus GAGTTTGCAAGGATATGAATCCAATGGCAACAGTGAAGACAATTCTCCTTACTTTGTACG
 
. : . : . : . : . : . :
JMSF045F15- GAGGTGGTCACCTAAGTTGGATGATTTACTTGGTGAGAACTCAGTAGGTGTGGATTGGAG
JMSF044F15- GAGGTGGTCACCTAAGTTGGATGATTTACTTGGTGAGAACTCAGTAGGTGTGGATTGGAG
                      ____________________________________________________________
consensus GAGGTGGTCACCTAAGTTGGATGATTTACTTGGTGAGAACTCAGTAGGTGTGGATTGGAG
 
. : . : . : . : . : . :
JMSF045F15- GCGCTCATATTACTTGAACTTGATTGCTCATACAACTTTCAGTGTGACAGTGGCAATTTG
JMSF044F15- GCGCTCATATTACTTGAACTTGATTGCTCATACAACTTTCAGTGTGACAGTGGCAATTTG
                      ____________________________________________________________
consensus GCGCTCATATTACTTGAACTTGATTGCTCATACAACTTTCAGTGTGACAGTGGCAATTTG
 
. : . : . : . : . : . :
JMSF044F15- CAGTCACGAGGTCCTTAAAAATTACCAAACTGGCAAAGACAAGCCATTGTCTCCTATATA
                      ____________________________________________________________
consensus CAGTCACGAGGTCCTTAAAAATTACCAAACTGGCAAAGACAAGCCATTGTCTCCTATATA
 
. : . : . : . : . : . :
JMSF044F15- CAAGGTTGTGAAGACTGTCTATGCATCTCCAAGTCGTATTAATTTTCATTTGGACTCAAG
                      ____________________________________________________________
consensus CAAGGTTGTGAAGACTGTCTATGCATCTCCAAGTCGTATTAATTTTCATTTGGACTCAAG
 
. : . : . : . : . : . :
JMSF044F15- AAAGGAAGTAGAAACAACTCCTGCGTATCCAGATATATGTTTTGCCGTTGATGATTTTGA
rJMSF044F15+ TATCCAGATATATGTTTTGCCGTTGATGATTTTGA
                      ____________________________________________________________
consensus AAAGGAAGTAGAAACAACTCCTGCGTATCCAGATATATGTTTTGCCGTTGATGATTTTGA
 
. : . : . : . : . : . :
JMSF044F15- TTCTACTTTTGATGCANTGGTTTTGACAGATGTGGACCACTGCTATTGTGTAATTCTAAA
rJMSF044F15+ TTCTACTTTTGATGCAGTGGTTTTGACAGATGTGGACCACTGCTATTGTGTAATTCTAAA
                      ____________________________________________________________
consensus TTCTACTTTTGATGCAGTGGTTTTGACAGATGTGGACCACTGCTATTGTGTAATTCTAAA
 
. : . : . : . : . : . :
JMSF044F15- TG
rJMSF044F15+ TGCAAATGATGGGGCTGCATTTCCCAGTGACTCTTCCCAAAGTGAGACAAGTGGTGGAAA
                      ____________________________________________________________
consensus TGCAAATGATGGGGCTGCATTTCCCAGTGACTCTTCCCAAAGTGAGACAAGTGGTGGAAA
 
. : . : . : . : . : . :
rJMSF044F15+ GACTCAGAGTTCAAAGATCACTATATTCTCGGGTTTCGTTAGCTACCAGATGGTCCGAGA
                      ____________________________________________________________
consensus GACTCAGAGTTCAAAGATCACTATATTCTCGGGTTTCGTTAGCTACCAGATGGTCCGAGA
 
. : . : . : . : . : . :
rJMSF045F15+ GGAAGAACTGGATNTGGGAGTNTTCTTNCACTTCATTCTTCAGGGAA
rJMSF044F15+ TGCCTATGATGCTGGAAGAACTGGATTTGGGAGTCTTCTTTCACTTCATTCTTCAGGGAA
                      ____________________________________________________________
consensus TGCCTATGATGCTGGAAGAACTGGATTTGGGAGTCTTCTTTCACTTCATTCTTCAGGGAA
 
. : . : . : . : . : . :
rJMSF045F15+ AACGGNCAGGATATACATGAAAGNTCCAGGAGGNCGTGGGGAANTTGAAGTAGCTGTTTC
rJMSF044F15+ AACGGACAGGATATACATGAAAGGTCCAGGAGGACGTGGGGAAGTTGAAGTAGCTGTTTC
                      ____________________________________________________________
consensus AACGGACAGGATATACATGAAAGGTCCAGGAGGACGTGGGGAAGTTGAAGTAGCTGTTTC
 
. : . : . : . : . : . :
rJMSF045F15+ TGGTGNTGTAGATCAAAGCAAGGAGGAATNCGGTCATCATCCTCCTAAAAAAGGATTAAG
rJMSF044F15+ TGGTGTTGTAGATCAAAGCAAGGAGGAATACGGTCATCATCCTCCTAAAAAAGGATTAAG
                      ____________________________________________________________
consensus TGGTGTTGTAGATCAAAGCAAGGAGGAATACGGTCATCATCCTCCTAAAAAAGGATTAAG
 
. : . : . : . : . : . :
rJMSF045F15+ TTTCAGNGCAGTTGTTCGAAGGGCAGCATCAGTTGCATCGGTGGCAGNTAAGCATGCTTA
rJMSF044F15+ TTTCAGTGCAGTTGTTCGAAGGGCAGCATCAGTTGCATCGGTGGCAGCTAAGCATGCTTA
                      ____________________________________________________________
consensus TTTCAGTGCAGTTGTTCGAAGGGCAGCATCAGTTGCATCGGTGGCAGCTAAGCATGCTTA
 
. : . : . : . : . : . :
rJMSF045F15+ TGCTGCTGCTTCTGCTACACGGAGCTCAGATGAAGAGATGATCCCCCTAAAGTGTTGCTT
rJMSF044F15+ TGCTGCTGCTTCTGCTACACGGAGCTCAGATGAAGAGATGATCCCCCTAAAGTGTTGCTT
                      ____________________________________________________________
consensus TGCTGCTGCTTCTGCTACACGGAGCTCAGATGAAGAGATGATCCCCCTAAAGTGTTGCTT
 
. : . : . : . : . : . :
rJMSF045F15+ AATGTCAATATCATTGCCCTGGGAGCACATCGCTCATGATCTTCTCCTTAAGGGAAGTCC
rJMSF044F15+ AATGTCAATATCATTGCCCTGGGAGCACATCGCTCATGATCTTCTCCTTAAGGGAAGTCC
                      ____________________________________________________________
consensus AATGTCAATATCATTGCCCTGGGAGCACATCGCTCATGATCTTCTCCTTAAGGGAAGTCC
 
. : . : . : . : . : . :
rJMSF045F15+ CCCGGTGAACTNGTAGGAATGCAGATGATTGGTGATGGGCAGTATCAACTATCAAGTACT
rJMSF044F15+ CCCGGTGAACTTGTAGGAATGCAGATGATTGGTGATGGGCAGTATCAACTATCAAGTACT
                      ____________________________________________________________
consensus CCCGGTGAACTTGTAGGAATGCAGATGATTGGTGATGGGCAGTATCAACTATCAAGTACT
 
. : . : . : . : . : . :
rJMSF045F15+ TTCTCAACTTTACCTTGTAGATGAGTATATCCAAGATTAAAGCTAAGAAAACATGCATAG
rJMSF044F15+ TTCTCAACTTTACCTTGTAGATGAGTATATCCAAGATTAAA-CTAAGAAAACATGCATAG
                      ____________________________________________________________
consensus TTCTCAACTTTACCTTGTAGATGAGTATATCCAAGATTAAAGCTAAGAAAACATGCATAG
 
. : . : . : . : . : . :
rJMSF045F15+ CGAGCNTGGTTAGAAAGCATTGTGATATCATGTCTTGTACATT
rJMSF044F15+ CGAGCTTGGTTAGAAAGCATTGTGATATCATGTCTTGTACATTACAGTTCTCTTGTCTGA
                      ____________________________________________________________
consensus CGAGCTTGGTTAGAAAGCATTGTGATATCATGTCTTGTACATTACAGTTCTCTTGTCTGA