Previous Contig 013532:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF044D08Sequence148013532 (2)183013532 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044D08- GGC
                      ____________________________________________________________
consensus GGC
 
. : . : . : . : . : . :
JMSF044D08- ATTCAGCCACCATCCTTACTTTGCTACTGCTATTGTCAAGAGATCTTGATAAAATTTTTG
rJMSF044D08+ TTCAGCCNCCNTCCTTACTTTGNTACTGCTATTGTCNAGNGATCTTGATAAAATTTTTG
                      ____________________________________________________________
consensus ATTCAGCCACCATCCTTACTTTGCTACTGCTATTGTCAAGAGATCTTGATAAAATTTTTG
 
. : . : . : . : . : . :
JMSF044D08- CCATAGGTTCCTTTTTCTAATCCCCTTG-AAAAAAAGGGTATTAGATGGAGATTTTTTTT
rJMSF044D08+ CCNTAGGNTCCTTTTTTTAATCCCCNTGAAAAAAAAGGGNATTAGATGGNGATTTTTTTT
                      ____________________________________________________________
consensus CCATAGGTTCCTTTTTTTAATCCCCTTGAAAAAAAAGGGTATTAGATGGAGATTTTTTTT
 
. : . : . : . : . : . :
JMSF044D08- TTTTTTAATTATTTTTTNCCCCATTA
rJMSF044D08+ TTTTTTAATTATTTTTTTCCCCATTAGGCTGCTGTAANCAGTAAGGGCCCTCTTTTATTT
                      ____________________________________________________________
consensus TTTTTTAATTATTTTTTTCCCCATTAGGCTGCTGTAANCAGTAAGGGCCCTCTTTTATTT