Previous Contig 013527:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025B01Sequence467001196 (11)pir|H86229|H862296e-04hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid723013527 (4)pir|H86229|H862292e-58hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid
JMSF012E05Sequence528003540 (2)gb:AP005838_18588202e-82Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJN708013527 (4)pir|H86229|H862295e-64hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid
JMSF020G01Sequence643019166pir|H86229|H862291e-49hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid736013527 (4)pir|H86229|H862295e-64hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid
JMSF044C05Sequence733001196 (11)pir|H86229|H862296e-49hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid738013527 (4)pir|H86229|H862291e-52hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889967 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012E05+ TCGAGGAACCAAATCTCACCCTCAAAAAGGCTAACAAATATTTGCAAGATTC
rJMSF020G01+ GGAACCAAATCTCACCCTCAAAAAGGCTAACAAATATTTGCAAGATTC
rJMFF025B01+ TTGCAAGATTC
rJMSF044C05+ TTGCCAGATTC
                      ____________________________________________________________
consensus TCGAGGAACCAAATCTCACCCTCAAAAAGGCTAACAAATATTTGCAAGATTC
 
. : . : . : . : . : . :
rJMSF012E05+ AATTGTCTCGATGAGGAAGCTCCTGCAGAAACAGGTTTCTGGATCGAAGAAAGGAGGCAA
rJMSF020G01+ AATTGTCTCGATGAGGAAGCTCCTGCAGAAACAGGTTTCTGGATCGAAGAAAGGAGGCAA
rJMFF025B01+ AATTGTTTNGATGAGGAAGCTCCTGCAGAAACAGGTTTCTGGATCGAAGAAA---GGCAA
rJMSF044C05+ AATTG-TTCGATGAGGAAGCTCCTGCAGAAACAGGTTTCTGGATCGAAGAAA---GGCAA
                      ____________________________________________________________
consensus AATTGTTTCGATGAGGAAGCTCCTGCAGAAACAGGTTTCTGGATCGAAGAAAGGAGGCAA
 
. : . : . : . : . : . :
rJMSF012E05+ CATAAATGTGAATAATGCTCAAAACAAACCCACGGTGGGGTTGATATACGTCAATGAGCA
rJMSF020G01+ CATAAATGTGAATAATGCTCAAAACAAACCCACGGTGGGGTTGATATACGTCAATGAGCA
rJMFF025B01+ CATAAATGTGAA---TGCCCAAAACAAACCCACGGTGGGGTTGATATATGTGAACGAGCA
rJMSF044C05+ CATAAATGTGAA---TGCCCAAAACAAACCCACGGTGGGGTTGATATATGTGAACGAGCA
                      ____________________________________________________________
consensus CATAAATGTGAATAATGCTCAAAACAAACCCACGGTGGGGTTGATATATGTGAATGAGCA
 
. : . : . : . : . : . :
rJMSF012E05+ ATACGATGGGTGGAAAAAGGAGTGTTTGAACATACTCAGGAGGAAATTCGACGAGGCCTC
rJMSF020G01+ ATACGATGGGTGGAAAAAGGAGTGTTTGAACATACTCAGGAGGAAATTCGACGAGGCCTC
rJMFF025B01+ ATACGATGGGTGGAAAAGGGAGTGTTTGAACATACTCAGGACGAAATTCGACAAGGCCTC
rJMSF044C05+ ATACGATGGGTGGAAAAGGGAGTGTTTGAACATACTCAGGACGAAATTCGACAAGGCCTC
                      ____________________________________________________________
consensus ATACGATGGGTGGAAAAGGGAGTGTTTGAACATACTCAGGAGGAAATTCGACGAGGCCTC
 
. : . : . : . : . : . :
rJMSF012E05+ AAGCACCTTTTCACCCGACAAAGAAATCCTCGCTGAACTACAGCAGAGCGCAATCGCAAA
rJMSF020G01+ AAGCACCTTTTCACCCGACAAAGAAATCCTCGCTGAACTACAGCAGAGCGCAATCGCAAA
rJMFF025B01+ TCGCACCTTTTCACCCGACAAAGAAATCCTCGCCGAACTACAGCAGAGCGCAATTGCAAA
rJMSF044C05+ TCGCACCTTTTCACCCGACAAAGAAATCCTCGCCGAACTACAGCAGAGCGCAATTGCAAA
                      ____________________________________________________________
consensus TCGCACCTTTTCACCCGACAAAGAAATCCTCGCTGAACTACAGCAGAGCGCAATTGCAAA
 
. : . : . : . : . : . :
rJMSF012E05+ AGAAGGCAATTTCAAACAAATACAGAAGCTATGTATGCCATTCCTGAGATTCAAGAAGGA
rJMSF020G01+ AGAAGGCAATTTCAAACAAATACAGAAGCTATGTATGCCATTCCTGAGATTCAAGAAGGA
rJMFF025B01+ AGAAGGCAATTTCAAGCAAATACAGAAGCTATGCATGCCGTTCCTGAGATTCAAGAAGGA
rJMSF044C05+ AGAAGGCAATTTCAAGCAAATACAGAAGCTATGCATGCCGTTCCTGAGATTCAAGAAGGA
                      ____________________________________________________________
consensus AGAAGGCAATTTCAAGCAAATACAGAAGCTATGTATGCCGTTCCTGAGATTCAAGAAGGA
 
. : . : . : . : . : . :
rJMSF012E05+ TGAAGTTATGGGCGTAGGGGTTCAGGCACTGGATCTAAGACTTCCATTTGGCGAGATTGA
rJMSF020G01+ TGAAGTTATGGGCGTAGGGGTTCAGGCACTGGATCTAAGACTTCCATTTGGCGAGATTGA
rJMFF025B01+ CGAAGTTATGGCCGTTGGGGATCAGGCACTGGATCTAAAGCTTCCATTTGGCGAGATTGA
rJMSF044C05+ CGAAGTTATGGCCGTTGGGGATCAGGCACTGGATCTAAAGCTTCCATTTGGCGAGATTGA
                      ____________________________________________________________
consensus TGAAGTTATGGGCGTTGGGGTTCAGGCACTGGATCTAAGGCTTCCATTTGGCGAGATTGA
 
. : . : . : . : . : . :
rJMSF012E05+ GGTCCTCCAGACAAACTCAGACTTGATCAAAAGACAGCTTGGTCTTGAAAGATTGGAGAT
rJMSF020G01+ GGTCCTCCAGACAAACTCAGACTTGATCAAAAGACAGCTTGGTCTTGAAAGATTGGAGAT
rJMFF025B01+ GGTCCTAAACACAAACTCAGACTTGATCAAAAGACAGCTTGGTCTTGAAAGAATCGAGAT
rJMSF044C05+ GGTCCTAAACACAAACTCAGACTTGATCAAAAGACAGCTTGGTCTTGAAAGAATCGAGAT
                      ____________________________________________________________
consensus GGTCCTCCAGACAAACTCAGACTTGATCAAAAGACAGCTTGGTCTTGAAAGATTGGAGAT
 
. : . : . : . : . : . :
rJMSF012E05+ TTTGTCTGCTGCAGATCCAAATGCAATTGGAAGAGCCGGTCCTCATGCATCGCTTTTGAA
rJMSF020G01+ TTTGTCTGCTGCAGATCCAAATGCAATTGGAAGAGCCGGTCCTCATGCATCGCTTTTGAA
rJMFF025B01+ TTTGGATGCTGCAGAACCAACTGCAATTGGAAGAGCCGGTCCTCATGCATCGCTTTTGAA
rJMSF044C05+ TTTGGATGCTGCAGAACCAACTGCAATTGGAAGAGCCGGTCCTCATGCATCGCTTTTGAA
                      ____________________________________________________________
consensus TTTGTCTGCTGCAGATCCAACTGCAATTGGAAGAGCCGGTCCTCATGCATCGCTTTTGAA
 
. : . : . : . : . : . :
rJMSF012E05+ ACAGAATCCTCCATCACCTGGGAATCCAACCGCAATCTTCATCAACGAGTAAACTCAAAC
rJMSF020G01+ ACAGAATCCTCCATCACCTGGGAATCCAACCGCAATCTTCATCAACGAGTAAACTCAAAC
rJMFF025B01+ ACAGAATCCGCCATCTCCCGGGAATCCTACCTCAATCTTCATCAATGAGTAAACTCAAAG
rJMSF044C05+ ACAGAATCCGCCATCTCCCGGGAATCCTACCTCAATCTTCATCAATGAGTAAACTCAAAG
                      ____________________________________________________________
consensus ACAGAATCCTCCATCTCCTGGGAATCCTACCTCAATCTTCATCAATGAGTAAACTCAAAG
 
. : . : . : . : . : . :
rJMSF012E05+ ACAAACTTTTTGATCTATTGCCATTCACATCTGG-TTTAAGTTGTAATTT
rJMSF020G01+ ACAAACTTTTTGATCTATTGCCATTCACATCTGG-TTTAAGTTGTAATTT
rJMFF025B01+ ACACAAACTTT--TCTATCGCCATTCACATCTGGTTTTAAGTTGTAATTTTGTGGTTTCT
rJMSF044C05+ ACACAAACTTT--TCTATCGCCATTCACATCTGGTTTTAAGTTGTAATTTTGTGGTTTCT
                      ____________________________________________________________
consensus ACACACTTTTTGATCTATTGCCATTCACATCTGGTTTTAAGTTGTAATTTTGTGGTTTCT
 
. : . : . : . : . : . :
rJMFF025B01+ GGGTTTTTGTTAAACCGGATTTCCAGTCTTTACTTTGCTATACTGATTGTTGTTTCATCA
rJMSF044C05+ GGGTTTTTGTTAAACCGGATTTCCAGTCTTTACTTTGCTATACTGATTGTTGTTTCATCA
                      ____________________________________________________________
consensus GGGTTTTTGTTAAACCGGATTTCCAGTCTTTACTTTGCTATACTGATTGTTGTTTCATCA
 
. : . : . : . : . : . :
rJMFF025B01+ TTTTGGATGTTAATTATATTGTAAGCAGACTAGCAATACT
rJMSF044C05+ TTTTGGATGTTAATTATATTGTAAGCAGACTAGCAATACTGTTTTAATCCATTTTGAGAT
                      ____________________________________________________________
consensus TTTTGGATGTTAATTATATTGTAAGCAGACTAGCAATACTGTTTTAATCCATTTTGAGAT