Previous Contig 013523:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002D19Sequence550013523 (13)sp|Q9XG77|PSA6_TOBAC2e-87Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (720013523 (13)sp|Q9XG77|PSA6_TOBAC1e-88Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (
JMFF013O07Sequence712013523 (13)sp|Q9XG77|PSA6_TOBAC1e-84Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (
JMFF014C18Sequence536013523 (13)sp|Q9XG77|PSA6_TOBAC4e-75Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (777013523 (13)sp|Q9XG77|PSA6_TOBACe-106Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (
JMFF037J22Sequence512013523 (13)sp|Q9XG77|PSA6_TOBAC6e-74Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (506013523 (13)sp|Q9XG77|PSA6_TOBAC1e-46Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (
JMSF014F08Sequence324013523 (13)sp|Q9XG77|PSA6_TOBAC7e-44Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (785013523 (13)sp|Q9XG77|PSA6_TOBACe-111Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (
JMSF044B10Sequence761013523 (13)sp|Q9XG77|PSA6_TOBACe-115Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (633013523 (13)sp|Q9XG77|PSA6_TOBAC3e-73Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (
JMSF047L17Sequence670013523 (13)sp|Q9XG77|PSA6_TOBACe-111Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (777013523 (13)sp|Q9XG77|PSA6_TOBACe-104Proteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF014F08- AATC
JMFF002D19- CGTCTTTTCACTGAATC
JMSF047L17- GAATC
                      ____________________________________________________________
consensus CGTCTTTTCACTGAATC
 
. : . : . : . : . : . :
JMSF014F08- GGAAAACCAACTGCAAAGCTCTGACGAATTTCCAAAACATAAAAAAATGAGTAGAGGAAG
JMFF002D19- GGAAAACCAACTGCAAAGCTCTGACGAATTTCCAAAACATAAAAAAATGAGTAGAGGAAG
JMSF047L17- GGAAAACCAACTGCAAAGCTCTGACGAATTTCCAAAACATAAAAAAATGAGTAGAGGAAG
JMSF044B10- AAAAAATGAGTAGAGGAAG
                      ____________________________________________________________
consensus GGAAAACCAACTGCAAAGCTCTGACGAATTTCCAAAACATAAAAAAATGAGTAGAGGAAG
 
. : . : . : . : . : . :
JMFF014C18- GCGGCGGCTATGATCGGCATATTACGATCTTCTCGCCGGAAGGACGTCTCTTTCAAGT
JMFF037J22- GCGGCGGCTATGATCGGCATATTACGATCTTCTCGCCGGAAGGACGTCTCTTTCAAGT
JMSF014F08- CGGCGGCGGCTATGATCGGCATATTACGATCTTCTCGCCGGAAGGACGTCTCTTTCAAGT
JMFF002D19- CGGCGGCGGCTATGATCGGCATATTACGATCTTCTCGCCGGAAGGACGTCTCTTTCAAGT
JMSF047L17- CGGCGGCGGCTATGATCGGCATATTACGATCTTCTCGCCGGAAGGACGTCTCTTTCAAGT
JMSF044B10- CGGCGGCGGCTATGATCGGCATATTACGATCTTCTCGCCGGAAGGACGTCTCTTTCAAGT
                      ____________________________________________________________
consensus CGGCGGCGGCTATGATCGGCATATTACGATCTTCTCGCCGGAAGGACGTCTCTTTCAAGT
 
. : . : . : . : . : . :
JMFF014C18- CGAATACGCGTTTAAGGCTGTGAAGGCCGCGGGAATCACCTCCATTGGCGTCCGAGGAAA
JMFF037J22- CGAATACGCGTTTAAGGCTGTGAAGGCCGCGGGAATCACCTCCATTGGCGTCCGAGGAAA
JMSF014F08- CGAATACGCGTTTAAGGCTGTGAAGGCCGCGGGAATCACCTCCATTGGCGTCCGAGGAAA
JMFF002D19- CGAATACGCGTTTAAGGCTGTGAAGGCCGCGGGAATCACCTCCATTGGCGTCCGAGGAAA
JMSF047L17- CGAATACGCGTTTAAGGCTGTGAAGGCCGCGGGAATCACCTCCATTGGCGTCCGAGGAAA
JMSF044B10- CGAATACGCGTTTAAGGCTGTGAAGGCCGCGGGAATCACCTCCATTGGCGTCCGAGGAAA
rJMSF047L17+ ATCACCTCCATTGGCGTCCGAGGAAA
rJMSF014F08+ GCCGCGGGAATCACCTCCATTGGCGTCCGAGGAAA
rJMFF014C18+ CGAGGAAA
                      ____________________________________________________________
consensus CGAATACGCGTTTAAGGCTGTGAAGGCCGCGGGAATCACCTCCATTGGCGTCCGAGGAAA
 
. : . : . : . : . : . :
JMFF014C18- AGATTCTGTATGTGTGGTTACTCAGAAGAAAGTCCCGGACAAGCTA-TTGGATCAGACAA
JMFF037J22- AGATTCTGTATGTGTGGTTACTCAGAAGAAAGTCCCGGACAAGCTA-TTGGATCAGACAA
JMSF014F08- AGATTCTGTATGTGTGGTTACTCAGAAGAAAGTCCCGGACAAGCTA-TTGGATCAGACAA
JMFF002D19- AGATTCTGTATGTGTGGTTACTCAGAAGAAAGTCCCGGACAAGCTA-TTGGATCAGACAA
JMSF047L17- AGATTCTGTATGTGTGGTTACTCAGAAGAAAGTCCCGGACAAGCTA-TTGGATCAGACAA
JMSF044B10- AGATTCTGTATGTGTGGTTACTCAGAAGAAAGTCCCGGACAAGCTA-TTGGATCAGACAA
rJMSF047L17+ AGATTCTGTATGTGTGGTTACTCAGAAGAAAGTCCCGGACAAGCTATTTGGATCAGACAA
rJMSF014F08+ AGATTCTGTATGTGTGGTTACTCAGAAGAAAGTCCCGGACAAGCTA-TTGGATCAGACAA
rJMFF014C18+ AGATTCTGTATGTGTGGTTACTCAGAAGAAAGTCCCGGACAAGCTA-TTGGATCAGACAA
                      ____________________________________________________________
consensus AGATTCTGTATGTGTGGTTACTCAGAAGAAAGTCCCGGACAAGCTA-TTGGATCAGACAA
 
. : . : . : . : . : . :
JMFF014C18- GTGTAACCCATCTGTTTCCTGTAACCAAGTATCTTGGATTGTTGGCTACTGGAATAAC-A
JMFF037J22- GTGTAACCCATCTGTTTCCTGTAACCAAGTATCTTGGATTGTTGGCTACTGGAATAAC-A
JMSF014F08- GTGTAACCCATCTGTTTCCTGTAACCAAGTATCTTGGATTGTTGGCTACTGGAATAAC-A
JMFF002D19- GTGTAACCCATCTGTTTCCTGTAACCAAGTATCTTGGATTGTTGGCTACTGGAATAAC-A
JMSF047L17- GTGTAACCCATCTGTTTCCTGTAACCAAGTATCTTGGATTGTTGGCTACTGGAATAAC-A
JMSF044B10- GTGTAACCCATCTGTTTCCTGTAACCAAGTATCTTGGATTGTTGGCTACTGGAATAAC-A
rJMSF047L17+ GTGTAACCCATCTGTTTCCTGTAACCAAGTATCTTGGATTGTTGGCTACTGGAATAAC-A
rJMSF014F08+ GTGTAACCCATCTGTTTCCTGTAACCAAGTATCTTGGATTGTTGGCTACTGGAATAAC-A
rJMFF002D19+ TAACCAAGTATCTTGGATTGTTGGCTACTGGAATAAC-A
rJMFF013O07+ TCCTGTAACCAAGTATCTTGGATTGTTGGCTACTGGAATAACNA
rJMFF014C18+ GTGTAACCCATCTGTTTCCTGTAACCAAGTATCTTGGATTGTTGGCTACTGGAATAAC-A
                      ____________________________________________________________
consensus GTGTAACCCATCTGTTTCCTGTAACCAAGTATCTTGGATTGTTGGCTACTGGAATAAC-A
 
. : . : . : . : . : . :
JMFF014C18- GCTGATGCTAGGACCTTGGTCCAACAGGCTAGGAATGAAGCTGCTGAGTTCCGCTTTAGA
JMFF037J22- GCTGATGCTAGGACCTTGGTCCAACAGGCTAGGAATGAAGCTGCTGAGTTCCGCTTTAGA
JMSF014F08- GCTGATGCTAGGACCTTGGT
JMFF002D19- GCTGATGCTAGGACCTTGGTCCAACAGGCTAGGAATGAAGCTGCTGAGTTCCGCTTTAGA
JMSF047L17- GCTGATGCTAGGACCTTGGTCCAACAGGCTAGGAATGAAGCTGCTGAGTTCCGCTTTAGA
JMSF044B10- GCTGATGCTAGGACCTTGGTCCAACAGGCTAGGAATGAAGCTGCTGAGTTCCGCTTTAGA
rJMSF047L17+ GCTGATGCTAGGACCTTGGTCCAACAGGCTAGGAATGAAGCTGCTGAGTTCCGCTTTAGA
rJMSF014F08+ GCTGATGCTAGGACCTTGGTCCAACAGGCTAGGAATGAAGCTGCTGAGTTCCGCTTTAGA
rJMFF002D19+ GCTGATGCTAGGACCTTGGTCCAACAGGCTAGGAATGAAGCTGCTGAGTTCCGCTTTAGA
rJMFF013O07+ GCTGATGCTAGGACCTTGGTCCAACAGGCTAGGAATGAAGCTGCTGAGTTCCGCTTTAGA
rJMFF014C18+ GCTGATGCTAGGACCTTGGTCCAACAGGCTAGGAATGAAGCTGCTGAGTTCCGCTTTAGA
rJMSF044B10+ GGCTAGGAATGAAGCTGCTGAGTTCCGCTTTAGA
                      ____________________________________________________________
consensus GCTGATGCTAGGACCTTGGTCCAACAGGCTAGGAATGAAGCTGCTGAGTTCCGCTTTAGA
 
. : . : . : . : . : . :
JMFF014C18- TATGGATATGAAATGCCAGTGGATGTGCTGGCCAGATGGATTGCAGACAAATCACAGGTC
JMFF037J22- TATGGATATGAAATGCCAGTGGATGTGCTGGCCAGATGGATTGCAGACAAATCACAGGTC
JMFF002D19- TATGGATATGAAATGCCAGTGGATGTGCTGGCCAGATGGATTGCAGACAAATCACAGGTC
JMSF047L17- TATGGATATGAAATGCCAGTGGATGTGCTGGCCAGATGGATTGCAGACAAATCACAGGTC
JMSF044B10- TATGGATATGAAATGCCAGTGGATGTGCTGGCCAGATGGATTGCAGACAAATCACAGGTC
rJMSF047L17+ TATGGATATGAAATGCCAGTGGATGTGCTGGCCAGATGGATTGCAGACAAATCACAGGTC
rJMSF014F08+ TATGGATATGAAATGCCAGTGGATGTGCTGGCCAGATGGATTGCAGACAAATCACAGGTC
rJMFF002D19+ TATGGATATGAAATGCCAGTGGATGTGCTGGCCAGATGGATTGCAGACAAATCACAGGTC
rJMFF013O07+ TATGGATATGAAATGCCAGTGGATGTGCTGGCCAGATGGATTGCAGACAAATCACAGGTC
rJMFF014C18+ TATGGATATGAAATGCCAGTGGATGTGCTGGCCAGATGGATTGCAGACAAATCACAGGTC
rJMSF044B10+ TATGGATATGAAATGCCAGTGGATGTGCTGGCCAGATGGATTGCAGACAAATCACAGGTC
                      ____________________________________________________________
consensus TATGGATATGAAATGCCAGTGGATGTGCTGGCCAGATGGATTGCAGACAAATCACAGGTC
 
. : . : . : . : . : . :
JMFF014C18- TATACCCAGCATGCTTATATGAGACCACTTGGAGTAGTTGCAATGATTCTGGGTATAGAT
JMFF037J22- TATACCCAGCATGCTTATATGAGACCACTTGGAGTAGTTGCAATGATTCTGGGTAT
JMFF002D19- TATACCCAGCATGCTTATATGAGACCACTTGGAGTAGTTGCAATGATTCTGGGTATAGAT
JMSF047L17- TATACCCAGCATGCTTATATGAGACCACTTGGAGTAGTTGCAATGATTCTGGGTATAGAT
JMSF044B10- TATACCCAGCATGCTTATATGAGACCACTTGGAGTAGTTGCAATGATTCTGGGTATAGAT
rJMSF047L17+ TATACCCAGCATGCTTATATGAGACCACTTGGAGTAGTTGCAATGATTCTGGGTATAGAT
rJMSF014F08+ TATACCCAGCATGCTTATATGAGACCACTTGGAGTAGTTGCAATGATTCTGGGTATAGAT
rJMFF002D19+ TATACCCAGCATGCTTATATGAGACCACTTGGAGTAGTTGCAATGATTCTGGGTATAGAT
rJMFF013O07+ TATACCCAGCATGCTTATATGAGACCACTTGGAGTAGTTGCAATGATTCTGGGTATAGAT
rJMFF037J22+ TGGGTATAGNT
rJMFF014C18+ TATACCCAGCATGCTTATATGAGACCACTTGGAGTAGTTGCAATGATTCTGGGTATAGAT
rJMSF044B10+ TATACCCAGCATGCTTATATGAGACCACTTGGAGTAGTTGCAATGATTCTGGGTATAGAT
                      ____________________________________________________________
consensus TATACCCAGCATGCTTATATGAGACCACTTGGAGTAGTTGCAATGATTCTGGGTATAGAT
 
. : . : . : . : . : . :
JMFF014C18- GA
JMFF002D19- GAGGAGAAAGGCCCTCAGCTCTTCAAGTGTGATCCTGCAGGTCATTTTTTTGGTC
JMSF047L17- GAGGAGAAAGGCCCTCAGCTCTTCAAGTGTGATCCTGCAGGTCATTTTTTTGGTCACAAG
JMSF044B10- GAGGA-AAAGGCCCTCAGCTCTTCAAGTGTGATCCTGCAGGTCATTTTTTTGGTCACAAG
rJMSF047L17+ GAGGAGAAAGGCCCTCAGCTCTTCAAGTGTGATCCTGCAGGTCATTTTTTTGGTCACAAG
rJMSF014F08+ GAGGAGAAAGGCCCTCAGCTCTTCAAGTGTGATCCTGCAGGTCATTTTTTTGGTCACAAG
rJMFF002D19+ GAGGAGAAAGGCCCTCAGCTCTTCAAGTGTGATCCTGCAGGTCATTTTTTTGGTCACAAG
rJMFF013O07+ GAGGAGAAAGGCCCTCAGCTCTTCAAGTGTGATCCTGCAGGTCATTTTTTTGGTCACAAG
rJMFF037J22+ GAGGAGNAAGGCCCTCAGCTCTTCAAGTGTGATCCTGCAGGTCATTTTTTTGGTCACAAG
rJMFF014C18+ GAGGAGAAAGGCCCTCAGCTCTTCAAGTGTGATCCTGCAGGTCATTTTTTTGGTCACAAG
rJMSF044B10+ GAGGA-AAAGGCCCTCAGCTCTTCAAGTGTGATCCTGCAGGTCATTTTTTTGGTCACAAG
                      ____________________________________________________________
consensus GAGGAGAAAGGCCCTCAGCTCTTCAAGTGTGATCCTGCAGGTCATTTTTTTGGTCACAAG
 
. : . : . : . : . : . :
JMSF047L17- GCAACTAGTGCAGGAGTAAAAGAACAAGAGGCAATCAACTTTCTTGAGAAGAAAATGAAA
JMSF044B10- GCAACTAGTGCAGGAGTAAAAGAACAAGAGGCAATCAACTTTCTTGAGAAGAAAATGAAA
rJMSF047L17+ GCAACTAGTGCAGGAGTAAAAGAACAAGAGGCAATCAACTTTCTTGAGAAGAAAATGAAA
rJMSF014F08+ GCAACTAGTGCAGGAGTAAAAGAACAAGAGGCAATCAACTTTCTTGAGAAGAAAATGAAA
rJMFF002D19+ GCAACTAGTGCAGGAGTAAAAGAACAAGAGGCAATCAACTTTCTTGAGAAGAAAATGAAA
rJMFF013O07+ GCAACTAGTGCAGGAGTAAAAGAACAAGAGGCAATCAACTTTCTTGAGAAGAAAATGAAA
rJMFF037J22+ GCAANTAGTGCAGGAGTAAAAGAACAAGAGGCAATCAACTTTCTTGAGAAGAAAATGAAA
rJMFF014C18+ GCAACTAGTGCAGGAGTAAAAGAACAAGAGGCAATCAACTTTCTTGAGAAGAAAATGAAA
rJMSF044B10+ GCAACTAGTGCAGGAGTAAAAGAACAAGAGGCAATCAACTTTCTTGAGAAGAAAATGAAA
                      ____________________________________________________________
consensus GCAACTAGTGCAGGAGTAAAAGAACAAGAGGCAATCAACTTTCTTGAGAAGAAAATGAAA
 
. : . : . : . : . : . :
JMSF047L17- AATGACCCGGCTTTCAGTTACGAAGAAACTGTACAGACTGCAATCTCTGCTCTCCAATCT
JMSF044B10- AATGACCCGGCTTTCAGTTACGAAGAAACTGTACAGACTGCAATCTCTGCTCTCCAATCT
rJMSF047L17+ AATGACCCGGCTTTCAGTTACGAAGAAACTGTACAGACTGCAATCTCTGCTCTCCAATCT
rJMSF014F08+ AATGACCCGGCTTTCAGTTACGAAGAAACTGTACAGACTGCAATCTCTGCTCTCCAATCT
rJMFF002D19+ AATGACCCGGCTTTCAGTTACGAAAAAACTGTACAGACTGCAATCTCTGCTCTCCAATCT
rJMFF013O07+ AATGACCCGGCTTTCAGTTACGAAAAAACTGTACAGACTGCAATCTCTGCTCTCCAATCT
rJMFF037J22+ AATGACNCGGCTTTCAGTTACGAAAAAACTGTACAGACTGCAATCTCTGCTCTCCAATCT
rJMFF014C18+ AATGACCCGGCTTTCAGTTACGAAGAAACTGTACAGACTGCAATCTCTGCTCTCCAATCT
rJMSF044B10+ AATGACCCGGCTTTCAGTTACGAAGAAACTGTACAGACTGCAATCTCTGCTCTCCAATCT
                      ____________________________________________________________
consensus AATGACCCGGCTTTCAGTTACGAAGAAACTGTACAGACTGCAATCTCTGCTCTCCAATCT
 
. : . : . : . : . : . :
JMSF047L17- GTTCT
JMSF044B10- GTTCTACAAGAAGATTTCAAGGCCAGTGAGATTGAGATTGGCGTTGTGAGGCAAGAAG
rJMSF047L17+ GTTCTACAAGAAGATTTCAAGGCCAGTGAGATTGAGATTGGCGTTGTGAGGCAAGAAGAT
rJMSF014F08+ GTTCTACAAGAAGATTTCAAGGCCAGTGAGATTGAGATTGGCGTTGTGAGGCAAGAAGAT
rJMFF002D19+ GTTCTACAAGAAGATTTCAAGGCCAGTGAGATTGAGATTGGCGTTGTGAGGCAAGAAGAT
rJMFF013O07+ GTTCTACAAGAAGATTTCAAGGCCAGTGAGATTGAGATTGGCGTTGTGAGGCAAGAAGAT
rJMFF037J22+ GTTCTACAAGAAGATTTCAAGGCCAGTGAGATTGAGATTGGCGTTGTGAGGCAAGAAGAT
rJMFF014C18+ GTTCTACAAGAAGATTTCAAGGCCAGTGAGATTGAGATTGGCGTTGTGAGGCAAGAAGAT
rJMSF044B10+ GTTCTACAAGAAGATTTCAAGGCCAGTGAGATTGAGATTGGCGTTGTGAGGCAAGAAGAT
                      ____________________________________________________________
consensus GTTCTACAAGAAGATTTCAAGGCCAGTGAGATTGAGATTGGCGTTGTGAGGCAAGAAGAT
 
. : . : . : . : . : . :
rJMSF047L17+ CCATCCTTTAGAGTGTTATCCACTGTAGAGATTGATGAGCATTTGACAGCCATCAGCGAG
rJMSF014F08+ CCATCCTTTAGAGTGTTATCCACTGTAGAGATTGATGAGCATTTGACAGCCATCAGCGAG
rJMFF002D19+ CCATCCTTTAGAGTGTTATCCACTGTAGAGATTGATGAGCATTTGACAGCCATCAGCGAG
rJMFF013O07+ CCATCCTTTAGAGTGTTATCCACTGTAGAGATTGATGAGCATTTGACAGCCATCAGCGAG
rJMFF037J22+ CCATCCTTTAGAGTGTTATCCACTGTAGAGATTGATGAGCATTTGACAGCCATCAGCGAG
rJMFF014C18+ CCATCCTTTAGAGTGTTATCCACTGTAGAGATTGATGAGCATTTGACAGCCATCAGCGAG
rJMSF044B10+ CCATCCTTTAGAGTGTTATCCACTGTAGAGATTGATGAGCATTTGACAGCCATCAGCGAG
                      ____________________________________________________________
consensus CCATCCTTTAGAGTGTTATCCACTGTAGAGATTGATGAGCATTTGACAGCCATCAGCGAG
 
. : . : . : . : . : . :
rJMSF047L17+ CGTGACTAATCAGCCACACAATACTTATTTTACGTTGAAATCTGTGGTGAAAGTTGGTGA
rJMSF014F08+ CGTGACTAATCAGCCACACAATACTTATTTTACGTTGAAATCTGTGGTGAAAGTTGGTGA
rJMFF002D19+ CGTGACTAA
rJMFF013O07+ CGTGACTAAT
rJMFF037J22+ CGTGACTAAT
rJMFF014C18+ CGTGACTAATCAGCCACACAATACTTATTTTACGTTGAAATCTGTGGTGAAAGTTGGTGA
rJMSF044B10+ CGTGACTAATCAGCCACACAATACTTATTTTACGTTGAAATCTGTGGTGAAAGTTGGTGA
                      ____________________________________________________________
consensus CGTGACTAATCAGCCACACAATACTTATTTTACGTTGAAATCTGTGGTGAAAGTTGGTGA
 
. : . : . : . : . : . :
rJMSF047L17+ GATTCACTTCACTTTTCAGTAGTAAGACATTGTTTCGTACGCATGGCGCCTTGAATTCAG
rJMSF014F08+ GATTCACTTCACTTTTCAGTAGTAAGACATTGTTTCGTACGCATGGCGCCTTGAATTCAG
rJMFF014C18+ GATTCACTTCACTTTTCAGTAGTAAGACATTGTTTCGTACGCATGGCGCCTTGAATTCAG
rJMSF044B10+ GATTCACTTCACTTTTCAGTAGTAAGACATTGTTTCGTACGCATGGCGCCTTGAATTCAG
                      ____________________________________________________________
consensus GATTCACTTCACTTTTCAGTAGTAAGACATTGTTTCGTACGCATGGCGCCTTGAATTCAG
 
. : . : . : . : . : . :
rJMSF047L17+ ACATTGTTTCATTTCAGATTGTTGTAGACTTC
rJMSF014F08+ ACATTGTTTCATTTCAGATTGTTGTAGACTTC
rJMFF014C18+ ACATTGTTTCATTTCAGATTGTTGTAGACTTCTTGTAGTTAATTAAAATTG
rJMSF044B10+ ACATTGTTTCATTTCAGATTGTTGTAGACTTCTTGTAGTTAATTAAAATTGAGTATCTTT
                      ____________________________________________________________
consensus ACATTGTTTCATTTCAGATTGTTGTAGACTTCTTGTAGTTAATTAAAATTGAGTATCTTT