Previous Contig 013522:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF041O11Sequence748007452 (5)sp|O48901|DPOD_SOYBN5e-73DNA polymerase delta catalytic subunit (EC 2.7.7.7).>pir|T05731|T05731 DNA-direc708013522 (3)sp|Q9LRE6|DPOD_ORYSA1e-66DNA polymerase delta catalytic subunit (EC 2.7.7.7).>gb:AB037899_1519154 Oryza s
JMSF042E14Sequence830007452 (5)sp|O48901|DPOD_SOYBN5e-82DNA polymerase delta catalytic subunit (EC 2.7.7.7).>pir|T05731|T05731 DNA-direc800013522 (3)sp|Q9LRE6|DPOD_ORYSA2e-88DNA polymerase delta catalytic subunit (EC 2.7.7.7).>gb:AB037899_1519154 Oryza s
JMSF044A24Sequence690007452 (5)sp|O48901|DPOD_SOYBN8e-64DNA polymerase delta catalytic subunit (EC 2.7.7.7).>pir|T05731|T05731 DNA-direc303013522 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042E14+ AGCGGATGCGCNAGCGAGATGCTGCTACTGCTCCAAATATGGGTG
                      ____________________________________________________________
consensus AGCGGATGCGCNAGCGAGATGCTGCTACTGCTCCAAATATGGGTG
 
. : . : . : . : . : . :
rJMSF042E14+ ATAGAGTACCTTATGTCATTGTTAAGGGTGCTAAAGGTGCTAAGGCTTATGAAAAATCAG
rJMSF041O11+ TCAG
                      ____________________________________________________________
consensus ATAGAGTACCTTATGTCATTGTTAAGGGTGCTAAAGGTGCTAAGGCTTATGAAAAATCAG
 
. : . : . : . : . : . :
rJMSF042E14+ AGGATCCTATATATGTCTTAGAAAACAACATT-CCAATAGATCCACAGTACTATCTTGAA
rJMSF041O11+ AGGATCCTATATATGTCTTAGAAAACANCATTCCCAATAGATCCACAGTACTATCTTGAA
                      ____________________________________________________________
consensus AGGATCCTATATATGTCTTAGAAAACAACATTCCCAATAGATCCACAGTACTATCTTGAA
 
. : . : . : . : . : . :
rJMSF042E14+ AATCAGATTAGCAAGCCACTTCTAAGGATATTTGAGCCCATATTGAAGAATGCCAGTAAA
rJMSF041O11+ AATCAGATTAGCAAGCCACTTCTAAGGATATTTGAGCCCATATTGAAGAATGCCAGTAAA
                      ____________________________________________________________
consensus AATCAGATTAGCAAGCCACTTCTAAGGATATTTGAGCCCATATTGAAGAATGCCAGTAAA
 
. : . : . : . : . : . :
rJMSF042E14+ GAGCTTCTGCATGGAAGCCATACTAGATCGATCTCCATTTCAACTCCTTCCACCGGTGGC
rJMSF041O11+ GAGCTTCTGCATGGAAGCCATACTAGATCGATCTCCATTTCAACTCCTTCCACCGGTGGC
                      ____________________________________________________________
consensus GAGCTTCTGCATGGAAGCCATACTAGATCGATCTCCATTTCAACTCCTTCCACCGGTGGC
 
. : . : . : . : . : . :
rJMSF042E14+ ATAATGAAATTTGCCAAAAAACAATTAACTTGCATTGGATGCAAGGCACTAATCAGTGAA
rJMSF041O11+ ATAATGAAATTTGCCAAAAAACAATTAACTTGCATTGGATGCAAGGCACTAATCAGTGAA
                      ____________________________________________________________
consensus ATAATGAAATTTGCCAAAAAACAATTAACTTGCATTGGATGCAAGGCACTAATCAGTGAA
 
. : . : . : . : . : . :
rJMSF042E14+ TCAGATCGAACTCTGTGCAAGCACTGCAAGGGAAGAGAAGCTGAACTTTATTGTAGATCA
rJMSF041O11+ TCAGATCGAACTCTGTGCAAGCACTGCAAGGGAAGAGAAGCTGAACTTTATTGTAGATCA
                      ____________________________________________________________
consensus TCAGATCGAACTCTGTGCAAGCACTGCAAGGGAAGAGAAGCTGAACTTTATTGTAGATCA
 
. : . : . : . : . : . :
rJMSF042E14+ GTTGCAAATGTGGCTGAACTAGAGAAGCTGTTTGGGAGGTTGTGGACACAGTGCCAAGAG
rJMSF041O11+ GTTGCAAATGTGGCTGAACTAGAGAAGCTGTTTGGGAGGTTGTGGACACAGTGCCAAGAG
                      ____________________________________________________________
consensus GTTGCAAATGTGGCTGAACTAGAGAAGCTGTTTGGGAGGTTGTGGACACAGTGCCAAGAG
 
. : . : . : . : . : . :
rJMSF042E14+ TGTCAAGGCTCGCTTCATCAGGACGTGCTGTGCACCAGTCGAGACTGTCCCATCTTTTAT
rJMSF041O11+ TGTCAAGGCTCGCTTCATCAGGACGTGCTGTGCACCAGTCGAGACTGTCCCATCTTTTAT
                      ____________________________________________________________
consensus TGTCAAGGCTCGCTTCATCAGGACGTGCTGTGCACCAGTCGAGACTGTCCCATCTTTTAT
 
. : . : . : . : . : . :
rJMSF042E14+ CGAAGGAAGAAAGCGCAGAAAGACATGGCGTAAGCCAAGGTCCAATTAGATCGGTGGAGC
rJMSF041O11+ CGAAGGAAGAAAGCGCAGAAAGACATGGCGTAAGCCAAGGTCCAATTAGATCGGTGGAGC
                      ____________________________________________________________
consensus CGAAGGAAGAAAGCGCAGAAAGACATGGCGTAAGCCAAGGTCCAATTAGATCGGTGGAGC
 
. : . : . : . : . : . :
rJMSF042E14+ TTCTAGTATCTCACATGGGGGTCTCTGAATATGAGACCTCATCTTTACGTACAGTACACT
rJMSF041O11+ TTCTAGTATCTCACATGGGGGTCTCTGAATATGAGACCTCATCTTTACGTACAGTACACT
rJMSF044A24+ ACT
                      ____________________________________________________________
consensus TTCTAGTATCTCACATGGGGGTCTCTGAATATGAGACCTCATCTTTACGTACAGTACACT
 
. : . : . : . : . : . :
rJMSF042E14+ TAAGTACTGATGTAGAAAGCTTTTTACAAGCTCTAATAGTTAGGTTTATAAAAAAACCAG
rJMSF041O11+ TAAGTACTGATGTAGAAAGCTTTTTACAAGCTCTAATAGTTAGGTTTATAAAAAAACCAG
rJMSF044A24+ TAAGTACTGATGTAGAAAGCTTTTTACNAGCTNTAATAGNTAGGNTTATAAAAAAACCNG
                      ____________________________________________________________
consensus TAAGTACTGATGTAGAAAGCTTTTTACAAGCTCTAATAGTTAGGTTTATAAAAAAACCAG
 
. : . : . : . : . : . :
rJMSF042E14+ GGAAGTTCAGGGTTAGTAAACCAAACTTTACATTTGAGCACTTGTGTCTCAAGTTTTCTG
rJMSF041O11+ GGAAGTTCAGGGTTAGTAAACCAAACTTTACATTTGAGCACTTGTGTCTCAAGTTTTCTG
rJMSF044A24+ GGAAGTTCNGGGNTAGTAAACCNAACTTTACNTTTGAGCNCTTGNGTNTCAAGTTTTCTG
                      ____________________________________________________________
consensus GGAAGTTCAGGGTTAGTAAACCAAACTTTACATTTGAGCACTTGTGTCTCAAGTTTTCTG
 
. : . : . : . : . : . :
rJMSF042E14+ TGCATTTTTTGCTCTAAAGTTATATTTTTATTCTTT
rJMSF041O11+ TGCATTTTTTGCTCTAAAGTTATATTTTTATTCTTT
rJMSF044A24+ NGCNTTTTTTGCTCTAAAGNTATATTTTTATTCTTTTTATTTATTTATTAAAATCCNATA
                      ____________________________________________________________
consensus TGCATTTTTTGCTCTAAAGTTATATTTTTATTCTTTTTATTTATTTATTAAAATCCNATA
 
. : . : . : . : . : . :
rJMSF044A24+ TGTATCTTGTTACNTGCNCCNAACNCTTAACTTTTAAGGGTTTTTTTTTTTGCAACTCTA
                      ____________________________________________________________
consensus TGTATCTTGTTACNTGCNCCNAACNCTTAACTTTTAAGGGTTTTTTTTTTTGCAACTCTA
 
. : . : . : . : . : . :
rJMSF044A24+ ACTTTTAGGCGTCCAAAGTCATTTCACACTCTAACTTTTACCGGGTTGTTTGGAATGTAT
                      ____________________________________________________________
consensus ACTTTTAGGCGTCCAAAGTCATTTCACACTCTAACTTTTACCGGGTTGTTTGGAATGTAT