Previous Contig 013520:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021H07Sequence551007588 (3)gb:AY054262_15630823e-44Arabidopsis thaliana AT3g13050/MGH6_16 mRNA, complete cds.>gb:BT004522_1637556 A740013520 (3)gb:AY054262_15630822e-59Arabidopsis thaliana AT3g13050/MGH6_16 mRNA, complete cds.>gb:BT004522_1637556 A
JMFF039F13Sequence521007588 (3)gb:AY054262_15630825e-42Arabidopsis thaliana AT3g13050/MGH6_16 mRNA, complete cds.>gb:BT004522_1637556 A744013520 (3)gb:AY054262_15630822e-57Arabidopsis thaliana AT3g13050/MGH6_16 mRNA, complete cds.>gb:BT004522_1637556 A
JMSF044A14Sequence492007588 (3)gb:AY054262_15630821e-28Arabidopsis thaliana AT3g13050/MGH6_16 mRNA, complete cds.>gb:BT004522_1637556 A653013520 (3)gb:AY054262_15630823e-45Arabidopsis thaliana AT3g13050/MGH6_16 mRNA, complete cds.>gb:BT004522_1637556 A

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF039F13+ TCGGAATGCTTGTTTGTGACAACGTGCCTGAGGCCAATGAAGAATTACTTTCCA
                      ____________________________________________________________
consensus TCGGAATGCTTGTTTGTGACAACGTGCCTGAGGCCAATGAAGAATTACTTTCCA
 
. : . : . : . : . : . :
rJMFF039F13+ GGCATAGAAACAAATTTGCTAATTACAAAGCGGCCTTTTCTTCTCTATTTCCTCTATTTT
rJMFF021H07+ TTTCTTCTCTATTTCCTCTATTTT
                      ____________________________________________________________
consensus GGCATAGAAACAAATTTGCTAATTACAAAGCGGCCTTTTCTTCTCTATTTCCTCTATTTT
 
. : . : . : . : . : . :
rJMFF039F13+ CATCTAGATTAATAAGAACTACCCTTCTTATTTGGGTAGTTTATTTTGGAAATTCATTTT
rJMFF021H07+ CATCTAGATTAATAAGAACTACCCTTCTTATTTGGGTAGTTTATTTTGGAAATTCATTTT
                      ____________________________________________________________
consensus CATCTAGATTAATAAGAACTACCCTTCTTATTTGGGTAGTTTATTTTGGAAATTCATTTT
 
. : . : . : . : . : . :
rJMFF039F13+ TGTATTATGGCGTTATATTGTTGACTTCAGAGCTTAGCAGCGACGAAGCTAAATGCATAT
rJMFF021H07+ TGTATTATGGCGTTATATTGTTGACTTCAGAGCTTAGCAGCGACGAAGCTAAATGCATAT
rJMSF044A14+ TGGCGTTATATTGTTGACTTCAGAGCTTAGCAGCGACGAAGCTAAATGCATAT
                      ____________________________________________________________
consensus TGTATTATGGCGTTATATTGTTGACTTCAGAGCTTAGCAGCGACGAAGCTAAATGCATAT
 
. : . : . : . : . : . :
rJMFF039F13+ CAACTACTCC-AAACTTGAACGATGACTATAGCCTTTACAGAGATTCCTTCATCACCAGT
rJMFF021H07+ CAACTACTCC-AAACTTGAACGATGACTATAGCCTTTACAGAGATTCCTTCATCACCAGT
rJMSF044A14+ CAACTACTCCAAAACTTGAACGATGACTATAGCCTTTACAGAGATTCCTTCATCACCAGT
                      ____________________________________________________________
consensus CAACTACTCC-AAACTTGAACGATGACTATAGCCTTTACAGAGATTCCTTCATCACCAGT
 
. : . : . : . : . : . :
rJMFF039F13+ CTAGCAGAGCTTCCTGGTCTTGTCTTATCAGCTGTCCTAGTGGACAAGGCTGGCCGTAAA
rJMFF021H07+ CTAGCAGAGCTTCCTGGTCTTGTCTTATCAGCTGTCCTAGTGGACAAGGCTGGCCGTAAA
rJMSF044A14+ CTAGCAGAGCTTCCTGGTCTTGTCTTATCAGCTGTCCTAGTGGACAAGGCTGGCCGTAAA
                      ____________________________________________________________
consensus CTAGCAGAGCTTCCTGGTCTTGTCTTATCAGCTGTCCTAGTGGACAAGGCTGGCCGTAAA
 
. : . : . : . : . : . :
rJMFF039F13+ ATGTCATTGGTACTTATGTACGGAGCAGGCTTCCTATTTCTCTTGCCACTCGTTATCCAT
rJMFF021H07+ ATGTCATTGGTACTTATGTACGGAGCAGGCTTCCTATTTCTCTTGCCACTCGTTATCCAT
rJMSF044A14+ ATGTCATTGGTACTTATGTACGGAGCAGGCTTCCTATTTCTCTTGCCACTCGTTATCCAT
                      ____________________________________________________________
consensus ATGTCATTGGTACTTATGTACGGAGCAGGCTTCCTATTTCTCTTGCCACTCGTTATCCAT
 
. : . : . : . : . : . :
rJMFF039F13+ GAGCACGAGTTTTTAACTACAGGTTTATTATTCGGAGCTCGTATGTGCTTTATTGGAACA
rJMFF021H07+ GAGCACGAGTTTTTAACTACAGGTTTATTATTCGGAGCTCGTATGTGCTTTATTGGAACA
rJMSF044A14+ GAGCACGAGTTTTTAACTACAGGTTTATTATTCGGAGCTCGTATGTGCTTTATTGGAACA
                      ____________________________________________________________
consensus GAGCACGAGTTTTTAACTACAGGTTTATTATTCGGAGCTCGTATGTGCTTTATTGGAACA
 
. : . : . : . : . : . :
rJMFF039F13+ TTCACTGTCGCTGGCATCTATTGCCCCGAGATTTATCCAACCTCTGTAAGAACAACCGGG
rJMFF021H07+ TTCACTGTCGCTGGCATCTATTGCCCCGAGATTTATCCAACCTCTGTAAGAACAACCGGG
rJMSF044A14+ TTCACTGTCGCTGGCATCTATTGCCCCGAGATTTATCCAACCTCTGTAAGAACAACCGGG
                      ____________________________________________________________
consensus TTCACTGTCGCTGGCATCTATTGCCCCGAGATTTATCCAACCTCTGTAAGAACAACCGGG
 
. : . : . : . : . : . :
rJMFF039F13+ GTTGGAGTTGCGAGCGCTGTTGGGCGCATCGCAGGCATGATCTGCCCGGTTGTCACGGTG
rJMFF021H07+ GTTGGAGTTGCGAGCGCTGTTGGGCGCATCGCAGGCATGATCTGCCCGGTTGTCACGGTG
rJMSF044A14+ GTTGGAGTTGCGAGCGCTGTTGGGCGCATCGCAGGCATGATCTGCCCGGTTGTCACGGTG
                      ____________________________________________________________
consensus GTTGGAGTTGCGAGCGCTGTTGGGCGCATCGCAGGCATGATCTGCCCGGTTGTCACGGTG
 
. : . : . : . : . : . :
rJMFF039F13+ CAATTCATCAGTGGCTGTGAAATGACTGCTGCAATACTTCTATTCGAGGCTGTAGCAATT
rJMFF021H07+ CAATTCATCAGTGGCTGTGAAATGACTGCTGCAATACTTCTATTCGAGGCTGTAGCAATT
rJMSF044A14+ CAATTCATCAGTGGCTGTGAAATGACTGCTGCAATACTTCTATTCGAGGCTGTAGCAATT
                      ____________________________________________________________
consensus CAATTCATCAGTGGCTGTGAAATGACTGCTGCAATACTTCTATTCGAGGCTGTAGCAATT
 
. : . : . : . : . : . :
rJMFF039F13+ CTTTCGGGAGTAGGAGCTTTGCTTTTCCCACTGGAAACCAAGGGCCGGAAGCTAACTGAT
rJMFF021H07+ CTTTCGGGAGTAGGAGCTTTGCTTTTCCCACTGGAAACCAAGGGCCGGAAGCTAACTGAT
rJMSF044A14+ CTTTCGGGAGTAGGAGCTTTGCTTTTCCCACTGGAAACCAAGGGCCGGAAGCTAACTGAT
                      ____________________________________________________________
consensus CTTTCGGGAGTAGGAGCTTTGCTTTTCCCACTGGAAACCAAGGGCCGGAAGCTAACTGAT
 
. : . : . : . : . : . :
rJMFF039F13+ ATTGTTTCTTCATGAAAGTTTTCTATGGATA
rJMFF021H07+ ATTGTTTCTTCATGAAAGTTTTCTATGGATATTGTTTAATGAAAGGTACTTTTAGTATAT
rJMSF044A14+ ATTGTTTCTTCATGAAAGTTTTCTATGGATATTGTTTAATGAAAGGTACTTTTAGTATAT
                      ____________________________________________________________
consensus ATTGTTTCTTCATGAAAGTTTTCTATGGATATTGTTTAATGAAAGGTACTTTTAGTATAT
 
. : . : . : . : . : . :
rJMFF021H07+ ACTTGAACTTGAGTAGCTGTAACAAATCACAAACAAAAGGCTCAACAAAT
rJMSF044A14+ ACTTGAACTTGAGTAGCTGTAACAAATCACAAACAAAAGGCTCAACAAATTCCAACCATT
                      ____________________________________________________________
consensus ACTTGAACTTGAGTAGCTGTAACAAATCACAAACAAAAGGCTCAACAAATTCCAACCATT