Previous Contig 013515:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN006D03Sequence639013515 (5)gb:AY079018_1568132e-100Arabidopsis thaliana AT3g05350/T12H1_32 mRNA, complete cds.>gb:BT001080_1635335
JMSF018A15Sequence297005731 (4)797013515 (5)gb:AY079018_15681323e-99Arabidopsis thaliana AT3g05350/T12H1_32 mRNA, complete cds.>gb:BT001080_1635335
JMSF025D24Sequence615005731 (4)gb:AY079018_15681322e-90Arabidopsis thaliana AT3g05350/T12H1_32 mRNA, complete cds.>gb:BT001080_1635335 744013515 (5)gb:AY079018_1568132e-103Arabidopsis thaliana AT3g05350/T12H1_32 mRNA, complete cds.>gb:BT001080_1635335
JMSF043O18Sequence759005731 (4)gb:AY079018_15681324e-51Arabidopsis thaliana AT3g05350/T12H1_32 mRNA, complete cds.>gb:BT001080_1635335 569013515 (5)gb:AY079018_15681323e-52Arabidopsis thaliana AT3g05350/T12H1_32 mRNA, complete cds.>gb:BT001080_1635335
JMSF048P06Sequence257005731 (4)709013515 (5)gb:AY079018_15681329e-90Arabidopsis thaliana AT3g05350/T12H1_32 mRNA, complete cds.>gb:BT001080_1635335

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN006D03- AAATAGTGCGGAATTGGAAGGCATGCAAAACTGTC
                      ____________________________________________________________
consensus AAATAGTGCGGAATTGGAAGGCATGCAAAACTGTC
 
. : . : . : . : . : . :
JMFN006D03- ATCTAAGAGATGCTGCTGCTCTAGCACATTTTTGGGCCTGGTTGGAGGAGGAAATCTGCA
                      ____________________________________________________________
consensus ATCTAAGAGATGCTGCTGCTCTAGCACATTTTTGGGCCTGGTTGGAGGAGGAAATCTGCA
 
. : . : . : . : . : . :
JMFN006D03- AGGATGTGGGTTTAACAGAGGTTCTGGTGCGAATGGTGCGATCATTCATTACAAACCAGA
rJMSF025D24+ AACCAGA
                      ____________________________________________________________
consensus AGGATGTGGGTTTAACAGAGGTTCTGGTGCGAATGGTGCGATCATTCATTACAAACCAGA
 
. : . : . : . : . : . :
JMFN006D03- GCCTGATAGTTGCAGCATTGTGAATCGACATGAGCTTTTCCTTTTGGATAGTGGTGCTCA
rJMSF025D24+ GCCTGATAGTTGCAGCATTGTGAATCGACATGAGCTTTTCCTTTTGGATAGTGGTGCTCA
rJMSF018A15+ GATAGTTGCAGCATNGGG-ATCGACATGAGCTTTTCCTTTTGGATAGTGGTGCTCA
                      ____________________________________________________________
consensus GCCTGATAGTTGCAGCATTGTGAATCGACATGAGCTTTTCCTTTTGGATAGTGGTGCTCA
 
. : . : . : . : . : . :
JMFN006D03- ATATGTTGATGGAACAACTGACATAACAAGGACAGTCCATTTTGGTGAACCATCTTCACG
rJMSF025D24+ ATATGTTGATGGAACAACTGACATAACAAGGACAGTCCATTTTGGTGAACCATCTTCACG
rJMSF048P06+ ACTGACATACCAAGGACAGTCCATTTTGGTGAACCATCTTCACG
rJMSF018A15+ ATATGTTGATGGAACAACTGACATAACAAGGACAGTCCATTTTGGTGAACCATCTTCACG
                      ____________________________________________________________
consensus ATATGTTGATGGAACAACTGACATAACAAGGACAGTCCATTTTGGTGAACCATCTTCACG
 
. : . : . : . : . : . :
JMFN006D03- AGAGAAAGAATGTTTCACTCGGGTTTTGCAGGGTCACATAGCACTTGACCAGGCTGTCTT
rJMSF025D24+ AGAGAAAGAATGTTTCACTCGGGTTTTGCAGGGTCACATAGCACTTGACCAGGCTGTCTT
rJMSF048P06+ AGAGAAAGAATGTTTCACTCGGGTTTTGCAGGGTCACATAGCACTTGACCAGGCTGTCTT
rJMSF018A15+ AGAGAAAGAATGTTTCACTCGGGTTTTGCAGGGTCACATAGCACTTGACCAGGCTGTCTT
                      ____________________________________________________________
consensus AGAGAAAGAATGTTTCACTCGGGTTTTGCAGGGTCACATAGCACTTGACCAGGCTGTCTT
 
. : . : . : . : . : . :
JMFN006D03- CCCCGAAAACACTCCAGGTTTTGTACTGGATGCATTTGCTCGATCATCCTTGTGGAAGGT
rJMSF025D24+ CCCCGAAAACACTCCAGGTTTTGTACTGGATGCATTTGCTCGATCATCCTTGTGGAAGGT
rJMSF048P06+ CCCCGAAAACACTCCAGGTTTTGTACTGGATGCATTTGCTCGATCATCCTTGTGGAAGGT
rJMSF018A15+ CCCCGAAAACACTCCAGGTTTTGTACTGGATGCATTTGCTCGATCATCCTTGTGGAAGGT
                      ____________________________________________________________
consensus CCCCGAAAACACTCCAGGTTTTGTACTGGATGCATTTGCTCGATCATCCTTGTGGAAGGT
 
. : . : . : . : . : . :
JMFN006D03- TGGCCTTGATTACCGACATGGAACTGGGCATGGTGTAGGAGCTGCACTAAATGTTCATGA
rJMSF025D24+ TGGCCTTGATTACCGACATGGAACTGGGCATGGTGTAGGAGCTGCACTAAATGTTCATGA
rJMSF048P06+ TGGCCTTGATTACCGACATGGAACTGGGCATGGTGTAGGAGCTGCACTAAATGTTCATGA
rJMSF018A15+ TGGCCTTGATTACCGACATGGAACTGGGCATGGTGTAGGAGCTGCACTAAATGTTCATGA
rJMSF043O18+ GGTGTAGGAGCTGCACTAAATGTTCATGA
                      ____________________________________________________________
consensus TGGCCTTGATTACCGACATGGAACTGGGCATGGTGTAGGAGCTGCACTAAATGTTCATGA
 
. : . : . : . : . : . :
JMFN006D03- AGGCCCTCAAGGCATTAGCTTCCGTTTTGGAAACATGACTCCCATGGTGCCAGGCATGGT
rJMSF025D24+ AGGCCCTCAAGGCATTAGCTTCCGTTTTGGAAACATGACTCCCATGGTGCCAGGCATGGT
rJMSF048P06+ AGGCCCTCAAGGCATTAGCTTCCGTTTTGGAAACATGACTCCCATGGTGCCAGGCATGGT
rJMSF018A15+ AGGCCCTCAAGGCATTAGCTTCCGTTTTGGAAACATGACTCCCATGGTGCCAGGCATGGT
rJMSF043O18+ AGGCCCTCAAGGCATTAGCTTCCGTTTTGGAAACATGACTCCCATGGTGCCAGGCATGGT
                      ____________________________________________________________
consensus AGGCCCTCAAGGCATTAGCTTCCGTTTTGGAAACATGACTCCCATGGTGCCAGGCATGGT
 
. : . : . : . : . : . :
JMFN006D03- AGTCAGCAATGAGCCCGGCTACTATGAAGACCATTCGTTTGGCATTCGGATTGAGAATCT
rJMSF025D24+ AGTCAGCAATGAGCCCGGCTACTATGAAGACCATTCGTTTGGCATTCGGATTGAGAATCT
rJMSF048P06+ AGTCAGCAATGAGCCCGGCTACTATGAAGACCATTCGTTTGGCATTCGGATTGAGAATCT
rJMSF018A15+ AGTCAGCAATGAGCCCGGCTACTATGAAGACCATTCGTTTGGCATTCGGATTGAGAATCT
rJMSF043O18+ AGTCAGCAATGAGCCCGGCTACTATGAAGACCATTCGTTTGGCATTCGGATTGAGAATCT
                      ____________________________________________________________
consensus AGTCAGCAATGAGCCCGGCTACTATGAAGACCATTCGTTTGGCATTCGGATTGAGAATCT
 
. : . : . : . : . : . :
JMFN006D03- TCTTTATGTCAAGGAAATGGACACTCCAAATCGTTTTGGCGGGATTGGATATCTTGGATT
rJMSF025D24+ TCTTTATGTCAAGGAAATGGACACTCCAAATCGTTTTGGCGGGATTGGATATCTTGGATT
rJMSF048P06+ TCTTTATGTCAAGGAAATGGACACTCCAAATCGTTTTGGCGGGATTGGATATCTTGGATT
rJMSF018A15+ TCTTTATGTCAAGGAAATGGACACTCCAAATCGTTTTGGCGGGATTGGATATCTTGGATT
rJMSF043O18+ TCTTTATGTCAAGGAAATGGACACTCCAAATCGTTTTGGCGGGATTGGATATCTTGGATT
                      ____________________________________________________________
consensus TCTTTATGTCAAGGAAATGGACACTCCAAATCGTTTTGGCGGGATTGGATATCTTGGATT
 
. : . : . : . : . : . :
JMFN006D03- TGAA
rJMSF025D24+ TGAAAAGCTTACTTTTGTTCCTGTACAGGCTAAATTGGTTGATTTGTCAATACTCTCTGC
rJMSF048P06+ TGAAAAGCTTACTTTTGTTCCTATACAGGCTAAATTGGTTGATTTGTCAATACTCTCTGC
rJMSF018A15+ TGAAAAGCTTACTTTTGTTCCTATACAGGCTAAATTGGTTGATTTGTCAATACTCTCTGC
rJMSF043O18+ TGAAAAGCTTACTTTTGTTCCTATACAGGCTAAATTGGTTGATTTGTCAATACTCTCTGC
                      ____________________________________________________________
consensus TGAAAAGCTTACTTTTGTTCCTATACAGGCTAAATTGGTTGATTTGTCAATACTCTCTGC
 
. : . : . : . : . : . :
rJMSF025D24+ TGCTGAGGTTGCTTGGCTGAATAGTTACCACTTGCAAGTGTGGGAGAAGGTTTCAGGTTT
rJMSF048P06+ TGCTGAGGTTGCTTGGCTGAATAGTTACCACTTGCAAGTGTGGGAGAAGGTTTCAGGTTT
rJMSF018A15+ TGCTGAGGTTGCTTGGCTGAATAGTTACCACTTGCAAGTGTGGGAGAAGGTTTCAGGTTT
rJMSF043O18+ TGCTGAGGTTGCTTGGCTGAATAGTTACCACTTGCAAGTGTGGGAGAAGGTTTCAGGTTT
                      ____________________________________________________________
consensus TGCTGAGGTTGCTTGGCTGAATAGTTACCACTTGCAAGTGTGGGAGAAGGTTTCAGGTTT
 
. : . : . : . : . : . :
rJMSF025D24+ AGTGGATGGTCGTGCTCGGGAATGGCTATGGAACAACACAAGGCCTATCGATTCATCTCC
rJMSF048P06+ AGTGGATGGTCGTGCTCGGGAATGGCTATGGAACAACACAAGGCCTATCGATTCATCTCC
rJMSF018A15+ AGTGGATGGTCGTGCTCGGGAATGGCTATGGAACAACACAAGGCCTATCGATTCATCTCC
rJMSF043O18+ AGTGGATGGTCGTGCTCGGGAATGGCTATGGAACAACACAAGGCCTATCGATTCATCTCC
                      ____________________________________________________________
consensus AGTGGATGGTCGTGCTCGGGAATGGCTATGGAACAACACAAGGCCTATCGATTCATCTCC
 
. : . : . : . : . : . :
rJMSF025D24+ AACTCCTACTTAGTTAGTTAGTTACTCTTTACCGCCATACCCCATACAAATATACGTCTG
rJMSF048P06+ AACTCCTACTTAGTTAGTTAGTTACTCTTTACCGCCATACCCCANACAAATATACGTCTG
rJMSF018A15+ AACTCCTACTTAGTTAGTTAGTTACTCTTTACCGCCATACCCCATACAAATATACGTCTG
rJMSF043O18+ AACTCCTACTTAGTTAGTTAGTTACTCTTTACCGCCATACCCCATACAAATATACGTCTG
                      ____________________________________________________________
consensus AACTCCTACTTAGTTAGTTAGTTACTCTTTACCGCCATACCCCATACAAATATACGTCTG
 
. : . : . : . : . : . :
rJMSF025D24+ TTGTGTATATCAAGCAT
rJMSF048P06+ TTGTGTATATCAAGCATTCAACCCTAAATATTTGTTCCAGTATGTCAAACTTAATTCGCT
rJMSF018A15+ TTGTGTATATCAAGCATTCAACCCTAAATATTTGTTCCAGTATGTCAAACTTAATTCGCT
rJMSF043O18+ TTGTGTATATCAAGCATTCAACCCTAAATATTTGTTCCAGTATGTCAAACTTAATTCGCT
                      ____________________________________________________________
consensus TTGTGTATATCAAGCATTCAACCCTAAATATTTGTTCCAGTATGTCAAACTTAATTCGCT
 
. : . : . : . : . : . :
rJMSF048P06+ GTATT
rJMSF018A15+ GTATTTGTCTAGTTCAAGTTTG
rJMSF043O18+ GTATTTGTCTAGTTCAAGTTTGGTGTATGTATGGAATAGTCCAAAAATGAAAATATGCTA
                      ____________________________________________________________
consensus GTATTTGTCTAGTTCAAGTTTGGTGTATGTATGGAATAGTCCAAAAATGAAAATATGCTA