Previous Contig 013511:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001K18Sequence420004338 (6)689013511 (3)pir|F84430|F844303e-18hypothetical protein At2g01910 [imported] - Arabidopsis thaliana>gb:AC007069_153
JMSF004H16Sequence388004338 (6)pir|F84430|F844301e-42hypothetical protein At2g01910 [imported] - Arabidopsis thaliana>gb:AC007069_153462013511 (3)gb:AK176215_18182032e-23Arabidopsis thaliana mRNA, partial cds, clone: RAFL23-09-L14.>gb:AK176300_181828
JMSF043N20Sequence750013511 (3)gb:AE005172_8904665e-19Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC006917_153466

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF001K18+ AA
rJMSF004H16+ AAAAAGAATTGAGGTATGGTTCTAA
rJMSF043N20+ CACTGAAAAAAGAATTGAGGTATGGTTCTAA
                      ____________________________________________________________
consensus CACTGAAAAAAGAATTGAGGTATGGTTCTAA
 
. : . : . : . : . : . :
rJMSF001K18+ ACCAAGTCCAAGGAGAAGCNATAGCTTTAGGAAGACAAAT-GGATTCCATACTAACGGAT
rJMSF004H16+ ACCAAGTCCAAGGAGAAGCAATAGCTTTAGGAAGACAAAT-GGATTCCATACTAACGGAT
rJMSF043N20+ ACCAAGTCCAAGGAGAAGCAATAGCTTTAGGAAGACAAATGGGATTCCATACTAACGGAT
                      ____________________________________________________________
consensus ACCAAGTCCAAGGAGAAGCAATAGCTTTAGGAAGACAAAT-GGATTCCATACTAACGGAT
 
. : . : . : . : . : . :
rJMSF001K18+ GTGTAACCCCCTCACCACGTCGGAATTCTGCTGGCTGTCAAACCCCCGAGCTTTTAACAC
rJMSF004H16+ GTGTAACCCCCTCACCACGTCGGAATTCTGCTGGCTGTCAAACCCCCGAGCTTTTAACAC
rJMSF043N20+ GTGTAACCCCCTCACCACGTCGGAATTCTGCTGGCTGTCAAACCCCCGAGCTTTTAACAC
                      ____________________________________________________________
consensus GTGTAACCCCCTCACCACGTCGGAATTCTGCTGGCTGTCAAACCCCCGAGCTTTTAACAC
 
. : . : . : . : . : . :
rJMSF001K18+ CCCGCTCATACTCTGGGCGACAGAATGGGTATTTCAGAGAAACTAGAAGGCNTTCAACTG
rJMSF004H16+ CCCGCTCATACTCTGGGCGACAGAATGGGTATTTCAGAGAAACTAGAAGGCTTTCAACTG
rJMSF043N20+ CCCGCTCATACTCTGGGCGACAGAATGGGTATTTCAGAGAAACTAGAAGGCTTTCAACTG
                      ____________________________________________________________
consensus CCCGCTCATACTCTGGGCGACAGAATGGGTATTTCAGAGAAACTAGAAGGCTTTCAACTG
 
. : . : . : . : . : . :
rJMSF001K18+ CCCCTCTGAATNTTGTGGCAATAGCAAAGGAGGATANGATGTCTTTTTCATCCGTTTCTG
rJMSF004H16+ CCCCTCTGAATTTTGTGGCAATAGCAAAGGAGGATATGATGTCTTTTTCATCCGTTTCTG
rJMSF043N20+ CCCCTCTGAATTTTGTGGCAATAGCAAAGGAGGATATGATGTCTTTTTCATCCGTTTCTG
                      ____________________________________________________________
consensus CCCCTCTGAATTTTGTGGCAATAGCAAAGGAGGATATGATGTCTTTTTCATCCGTTTCTG
 
. : . : . : . : . : . :
rJMSF001K18+ GTTCTGAACCAGAGTCTCCACTTCAACCCNGAATATGGAATTTAAACTGGGTGATACCAA
rJMSF004H16+ GTTCTGAACCAGAGTCTCCACTTCAACCCTGAATATGGAATTTAAACTGGGTGATACCAA
rJMSF043N20+ GTTCTGAACCAGAGTCTCCACTTCAACCCTGAATATGGAATTTAAACTGGGTGATACCAA
                      ____________________________________________________________
consensus GTTCTGAACCAGAGTCTCCACTTCAACCCTGAATATGGAATTTAAACTGGGTGATACCAA
 
. : . : . : . : . : . :
rJMSF001K18+ ATTATGGTTTGCTGTGGATTCACTCAGTAAGTAGGCCAACATGACTGGGAAGGAAGTACT
rJMSF004H16+ ATTATGGTTTGCTGTGGATTCACTCAGTAAGTAGGCCAACATGACTGGGAAGGAAGTACT
rJMSF043N20+ ATTATGGTTTGCTGTGGATTCACTCAGTAAGTAGGCCAACATGACTGGGAAGGAAGTACT
                      ____________________________________________________________
consensus ATTATGGTTTGCTGTGGATTCACTCAGTAAGTAGGCCAACATGACTGGGAAGGAAGTACT
 
. : . : . : . : . : . :
rJMSF001K18+ GAAACCTGTGAATATGAAAGAGGTATGTTTAGGGGATTGTAGACA-CAGTGGTAACAGGA
rJMSF004H16+ GAAACCTGTGAATATGAAAGAGGTATGTTTAGGGGATTGTAGACANCAGTGGTAA
rJMSF043N20+ GAAACCTGTGAATATGAAAGAGGTATGTTTAGGGGATTGTAGACA-CAGTGGTAACAGGA
                      ____________________________________________________________
consensus GAAACCTGTGAATATGAAAGAGGTATGTTTAGGGGATTGTAGACA-CAGTGGTAACAGGA
 
. : . : . : . : . : . :
rJMSF001K18+ GTGCAGTGCAGGAAAGTGGTATACTGAGTGAGAGATTAGTGNGGATATGAATTAGTTAAA
rJMSF043N20+ GTGCAGTGCAGGAAAGTGGTATACTGAGTGAGAGATTAGTGTGGATATGAATTAGTTAAA
                      ____________________________________________________________
consensus GTGCAGTGCAGGAAAGTGGTATACTGAGTGAGAGATTAGTGTGGATATGAATTAGTTAAA
 
. : . : . : . : . : . :
rJMSF001K18+ AGTGCAAAAATGTTGAGTATGGGAGACTACTACTTAGTACTGACCGACCATAATATGTNT
rJMSF043N20+ AGTGCAAAAATGTTGAGTATGGGAGACTACTACTTAGTACTGACCGACCATAATATGTGT
                      ____________________________________________________________
consensus AGTGCAAAAATGTTGAGTATGGGAGACTACTACTTAGTACTGACCGACCATAATATGTGT
 
. : . : . : . : . : . :
rJMSF001K18+ TATTTAAGGATTTGGTTTTTNGATGTACATATAATTGTGTNATTGGTTTGACTTCTGATT
rJMSF043N20+ TATTTAAGGATTTGGTTTTTGGATGTACATATAATTGTGTTATTGGTTTGACTTTTGATT
                      ____________________________________________________________
consensus TATTTAAGGATTTGGTTTTTGGATGTACATATAATTGTGTTATTGGTTTGACTTTTGATT
 
. : . : . : . : . : . :
rJMSF001K18+ GATGTGTAGTAGGTGTCTGGTCGTATCTATCTATCTATCTATCTATCTATCTANGTAGTA
rJMSF043N20+ GATGTGTAGTAGGTGTCTGGTTGTATCTATCTATCTATCTATCTATCTATCTATGTAGTA
                      ____________________________________________________________
consensus GATGTGTAGTAGGTGTCTGGTTGTATCTATCTATCTATCTATCTATCTATCTATGTAGTA
 
. : . : . : . : . : . :
rJMSF001K18+ TNTAGGGCTCTCAAGA
rJMSF043N20+ TGTAGGGCTCTCAAGACTTGTACTCCCCAGGCCTGTAGTGAAACAGANCAAGTTTGTATG
                      ____________________________________________________________
consensus TGTAGGGCTCTCAAGACTTGTACTCCCCAGGCCTGTAGTGAAACAGANCAAGTTTGTATG