Previous Contig 013503:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035L14Sequence653007039 (3)gb:AP003743_18327347e-40Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11652013503 (3)gb:AP003743_18327344e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMSF042G05Sequence804007039 (3)gb:AP003743_18327343e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11814013503 (3)gb:AP003743_18327347e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11
JMSF043L12Sequence793007039 (3)gb:AP003743_18327342e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11767013503 (3)gb:AP003743_18327346e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042G05+ TCCGCCACCTCCACNTCCTCCAAGGCAACAGCCNT
                      ____________________________________________________________
consensus TCCGCCACCTCCACNTCCTCCAAGGCAACAGCCNT
 
. : . : . : . : . : . :
rJMSF042G05+ TTAGTTCCTGGACCTGCTATAATCCCATCTTTGCAAACTGATATGTTGCCTCCAGGAATT
                      ____________________________________________________________
consensus TTAGTTCCTGGACCTGCTATAATCCCATCTTTGCAAACTGATATGTTGCCTCCAGGAATT
 
. : . : . : . : . : . :
rJMSF042G05+ TCTCGGTTCCCTCCACCTTCACCTCCTACAGATATGAGGCCACCACCCGGAATTGTTGGC
rJMSF043L12+ CCACCTTCACNTCCTACAGATATGAGGCCACCACCCGGAATTGTTGGC
                      ____________________________________________________________
consensus TCTCGGTTCCCTCCACCTTCACCTCCTACAGATATGAGGCCACCACCCGGAATTGTTGGC
 
. : . : . : . : . : . :
rJMSF042G05+ CAACCTCCTCCCCCTGGAGTAATGGTTCCACTAATTCCTAGGCCACCCTTTGGACCTCCA
rJMSF035L14+ TCCTCCCCCTGGAGTAATGGTTCCACTAATTCCTAGGCCACCCTTTGGACCTCCA
rJMSF043L12+ CAACCTCCTCCCCCTGGAGTAATGGTTCCACTAATTCCTAGGCCACCCTTTGGACCTCCA
                      ____________________________________________________________
consensus CAACCTCCTCCCCCTGGAGTAATGGTTCCACTAATTCCTAGGCCACCCTTTGGACCTCCA
 
. : . : . : . : . : . :
rJMSF042G05+ CCGATGATGAGACCACCACTTCCGCCCGGGCCACCTCCTATGCCGCAGGATAGTACCAGG
rJMSF035L14+ CCGATGATGAGACCACCACTTCCGCCCGGGCCACCTCCTATGCCGCAGGATAGTACCAGG
rJMSF043L12+ CCGATGATGAGACCACCACTTCCGCCCGGGCCACCTCCTATGCCGCAGGATAGTACCAGG
                      ____________________________________________________________
consensus CCGATGATGAGACCACCACTTCCGCCCGGGCCACCTCCTATGCCGCAGGATAGTACCAGG
 
. : . : . : . : . : . :
rJMSF042G05+ CCACTCATTTCTCAAAAGCCATCCTATGTTAAATCAGCTGCATCAACGGTTATTAAGAGG
rJMSF035L14+ CCACTCATTTCTCAAAAGCCATCCTATGTTAAATCAGCTGCATCAACGGTTATTAAGAGG
rJMSF043L12+ CCACTCATTTCTCAAAAGCCATCCTATGTTAAATCAGCTGCATCAACGGTTATTAAGAGG
                      ____________________________________________________________
consensus CCACTCATTTCTCAAAAGCCATCCTATGTTAAATCAGCTGCATCAACGGTTATTAAGAGG
 
. : . : . : . : . : . :
rJMSF042G05+ CCTCTTGCTCAGCATACTCCAGAACTTACTGCTATGGTTCCTGCATCTGTGCGTGTTAAG
rJMSF035L14+ CCTCTTGCTCAGCATACTCCAGAACTTACTGCTATGGTTCCTGCATCTGTGCGTGTTAAG
rJMSF043L12+ CCTCTTGCTCAGCATACTCCAGAACTTACTGCTATGGTTCCTGCATCTGTGCGTGTTAAG
                      ____________________________________________________________
consensus CCTCTTGCTCAGCATACTCCAGAACTTACTGCTATGGTTCCTGCATCTGTGCGTGTTAAG
 
. : . : . : . : . : . :
rJMSF042G05+ AGAGAATCTGCTCTTCCAAAATCAAAACCAAAGCCATCAACAACAGTTGTGGCCAACCAG
rJMSF035L14+ AGAGAATCTGCTCTTCCAAAATCAAAACCAAAGCCATCAACAACAGTTGTGGCCAACCAG
rJMSF043L12+ AGAGAATCTGCTCTTCCAAAATCAAAACCAAAGCCATCAACAACAGTTGTGGCCAACCAG
                      ____________________________________________________________
consensus AGAGAATCTGCTCTTCCAAAATCAAAACCAAAGCCATCAACAACAGTTGTGGCCAACCAG
 
. : . : . : . : . : . :
rJMSF042G05+ CCCATGTTTACTGCAGCAGTTTTGAAGCAAGAATCCACCAGTTCATCTCAACCAAAGCCA
rJMSF035L14+ CCCATGTTTACTGCAGCAGTTTTGAAGCAAGAATCCACCAGTTCATCTCAACCAAAGCCA
rJMSF043L12+ CCCATGTTTACTGCAGCAGTTTTGAAGCAAGAATCCACCAGTTCATCTCAACCAAAGCCA
                      ____________________________________________________________
consensus CCCATGTTTACTGCAGCAGTTTTGAAGCAAGAATCCACCAGTTCATCTCAACCAAAGCCA
 
. : . : . : . : . : . :
rJMSF042G05+ CAAAGTATCGATGACTCTTATATGGCTTTCCTGGAGGACATGAAAGCTCTTGGTGCTCTT
rJMSF035L14+ CAAAGTATCGATGACTCTTATATGGCTTTCCTGGAGGACATGAAAGCTCTTGGTGCTCTT
rJMSF043L12+ CAAAGTATCGATGACTCTTATATGGCTTTCCTGGAGGACATGAAAGCTCTTGGTGCTCTT
                      ____________________________________________________________
consensus CAAAGTATCGATGACTCTTATATGGCTTTCCTGGAGGACATGAAAGCTCTTGGTGCTCTT
 
. : . : . : . : . : . :
rJMSF042G05+ GATGGCAACAAATGACCCAACGGATAGATGGAAACTTGGGAAGGTGCAAAAGGGACAACT
rJMSF035L14+ GATGGCAACAAATGACCCAACGGATAGATGGAAACTTGGGAAGGTGCAAAAGGGACAACT
rJMSF043L12+ GATGGCAACAAATGACCCAACGGATAGATGGAAACTTGGGAAGGTGCAAAAGGGACAACT
                      ____________________________________________________________
consensus GATGGCAACAAATGACCCAACGGATAGATGGAAACTTGGGAAGGTGCAAAAGGGACAACT
 
. : . : . : . : . : . :
rJMSF042G05+ AGTAGCTACGACTGTGTGTGTGATGTTCTAAGAATTTATTTAATAGGGCATCATGTTATC
rJMSF035L14+ AGTAGCTACGACTGTGTGTGTGATGTTCTAAGAATTTATTTAATAGGGCATCATGTTATC
rJMSF043L12+ AGTAGCTACGACTGTGTGTGTGATGTTCTAAGAATTTATTTAATAGGGCATCATGTTATC
                      ____________________________________________________________
consensus AGTAGCTACGACTGTGTGTGTGATGTTCTAAGAATTTATTTAATAGGGCATCATGTTATC
 
. : . : . : . : . : . :
rJMSF042G05+ CGATCTGGTGGAGGTTTGGGGGGGTAGGAGAGGAGGGTGTAGAAAGGACATTCTTTTCTT
rJMSF035L14+ CGATCTGGTGGAGGTTTGGGGGGGTAGGAGAGGAGGGTGTAGAAAGGACATTCTTTTCTT
rJMSF043L12+ CGATCTGGTGGAGGTTTGGGGGGGTAGGAGAGGAGGGTGTAGAAAGGACATTCTTTTCTT
                      ____________________________________________________________
consensus CGATCTGGTGGAGGTTTGGGGGGGTAGGAGAGGAGGGTGTAGAAAGGACATTCTTTTCTT
 
. : . : . : . : . : . :
rJMSF042G05+ GAATTTTCTACTTTTCCATTCTGGTTGGCAATCTGCTGTAGCCGGACCAGAGTACGAA
rJMSF035L14+ GAATTTTCTACTTTTCCATTCTGGTTGGCAATCTGCTGTAGCCGGA-CAGAGTACGAA
rJMSF043L12+ GAATTTTCTACTTTTCCATTCTGGTTGGCAATCTGCTGTAGCCGGA-CAGAGTACGAATG
                      ____________________________________________________________
consensus GAATTTTCTACTTTTCCATTCTGGTTGGCAATCTGCTGTAGCCGGA-CAGAGTACGAATG
 
. : . : . : . : . : . :
rJMSF043L12+ TACTACTTCAGATAAAGAATACTTTTGTTTCAGCTTACAAGTTGCCCACTAACTATATAT
                      ____________________________________________________________
consensus TACTACTTCAGATAAAGAATACTTTTGTTTCAGCTTACAAGTTGCCCACTAACTATATAT