Previous Contig 013502:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011C02Sequence636013502 (6)gb:AY442256_16063347e-35Populus alba x Populus tremula clone cET-1-pop1-145 predicted protein mRNA, comp727020887gb:AY442256_16063342e-19Populus alba x Populus tremula clone cET-1-pop1-145 predicted protein mRNA, comp
JMFF040N11Sequence570014894gb:AY442256_16063344e-23Populus alba x Populus tremula clone cET-1-pop1-145 predicted protein mRNA, comp795013502 (6)gb:AY442256_16063341e-52Populus alba x Populus tremula clone cET-1-pop1-145 predicted protein mRNA, comp
JMSF043L04Sequence691013502 (6)gb:AY442256_16063348e-61Populus alba x Populus tremula clone cET-1-pop1-145 predicted protein mRNA, comp751013502 (6)gb:AY442256_16063342e-61Populus alba x Populus tremula clone cET-1-pop1-145 predicted protein mRNA, comp
JMSF048O13Sequence682013502 (6)gb:AY442256_16063343e-59Populus alba x Populus tremula clone cET-1-pop1-145 predicted protein mRNA, comp716013502 (6)gb:AY442256_16063342e-61Populus alba x Populus tremula clone cET-1-pop1-145 predicted protein mRNA, comp

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF040N11- TTTCTATTTCTTATTTANACATTACAGAGCATATTA
                      ____________________________________________________________
consensus TTTCTATTTCTTATTTANACATTACAGAGCATATTA
 
. : . : . : . : . : . :
rJMFF040N11- CAAATAGCAAATAAACTCTAAGAACAAACACAATAGTGTTGCTGCATCTGGACACTGAAA
                      ____________________________________________________________
consensus CAAATAGCAAATAAACTCTAAGAACAAACACAATAGTGTTGCTGCATCTGGACACTGAAA
 
. : . : . : . : . : . :
rJMFF040N11- TATAAATACAATTTTTATAGGACAAAAGAATGGCTCCATAATCCCACCATTCTTTCCTAA
rJMSF048O13- ATGGCTCCATAATCCCACCATTCTTTCCTAA
rJMSF043L04- ATGGCTCCATAATCCCACCATTCTTTCCTAA
                      ____________________________________________________________
consensus TATAAATACAATTTTTATAGGACAAAAGAATGGCTCCATAATCCCACCATTCTTTCCTAA
 
. : . : . : . : . : . :
rJMFF040N11- CATTTTCTATATATTTCTAAGCAAAAATAAACCAACAAACAAATTATGAATCCTCTGTAC
rJMSF048O13- CATTTTCTATATATTTCTAAGCAAAAATAAACCAACAAACAAATTATGAATCCTCTGTAC
rJMSF043L04- CATTTTCTATATATTTCTAAGCAAAAATAAACCAACAAACAAATTATGAATCCTCTGTAC
                      ____________________________________________________________
consensus CATTTTCTATATATTTCTAAGCAAAAATAAACCAACAAACAAATTATGAATCCTCTGTAC
 
. : . : . : . : . : . :
rJMFF040N11- CTTCACCCTCTACTGCATCATTCTCCTGTAACATGTCCATGAGCATGTTGATTTGGTTCT
rJMSF048O13- CTTCACCCTCTACTGCATCATTCTCCTGTAACATGTCCATGAGCATGTTGATTTGGTTCT
JMSF043L04+ TGCATCATTCTCCTGTAACATGTCCATGAGCATGTTGATTTGGTTCT
JMSF048O13+ TCCTGTAACATGTCCATGAGCATGTTGATTTGGTTCT
rJMSF043L04- CTTCACCCTCTACTGCATCATTCTCCTGTAACATGTCCATGAGCATGTTGATTTGGTTCT
                      ____________________________________________________________
consensus CTTCACCCTCTACTGCATCATTCTCCTGTAACATGTCCATGAGCATGTTGATTTGGTTCT
 
. : . : . : . : . : . :
rJMFF040N11- GCAACATCGTGTTTTGCCTCTCGACATCAGCCCGCTTGCTCCTCTCGTCCAGCAGCTGCA
rJMSF048O13- GCAACATCGTGTTTTGCCTCTCGACATCAGCCCGCTTGCTCCTCTCGTCCAGCAGCTGCA
JMSF043L04+ GCAACATCGTGTTTTGCCTCTCGACATCAGCCCGCTTGCTCCTCTCGTCCAGCAGCTGCA
JMSF048O13+ GCAACATCGTGTTTTGCCTCTCGACATCAGCCCGCTTGCTCCTCTCGTCCAGCAGCTGCA
rJMSF043L04- GCAACATCGTGTTTTGCCTCTCGACATCAGCCCGCTTGCTCCTCTCGTCCAGCAGCTGCA
                      ____________________________________________________________
consensus GCAACATCGTGTTTTGCCTCTCGACATCAGCCCGCTTGCTCCTCTCGTCCAGCAGCTGCA
 
. : . : . : . : . : . :
rJMFF040N11- GCTGCAGATGTTCCAAGCACCGTGAATCCGCTTCTAATTGCTCGTTCAGCCCATCAATTT
rJMSF048O13- GCTGCAGATGTTCCAAGCACCGTGAATCCGCTTCTAATTGCTCGTTCAGCCCATCAATTT
JMSF043L04+ GCTGCAGATGTTCCAAGCACCGTGAATCCGCTTCTAATTGCTCGTTCAGCCCATCAATTT
JMSF048O13+ GCTGCAGATGTTCCAAGCACCGTGAATCCGCTTCTAATTGCTCGTTCAGCCCATCAATTT
rJMSF043L04- GCTGCAGATGTTCCAAGCACCGTGAATCCGCTTCTAATTGCTCGTTCAGCCCATCAATTT
                      ____________________________________________________________
consensus GCTGCAGATGTTCCAAGCACCGTGAATCCGCTTCTAATTGCTCGTTCAGCCCATCAATTT
 
. : . : . : . : . : . :
rJMFF040N11- CTCGGTCCTTTCTGTTCATTTCCTGTACGGCAATCCTACGCATGCTCTCAACAACATCCA
JMFF011C02+ TTTCTGTTCATTTCCTGTACGGCAATCCTACGCATGCTCTCAACAACATCCA
rJMSF048O13- CTCGGTCCTTTCTGTTCATTTCCTGTACGGCAATCCTACGCATGCTCTCAACAACATCCA
JMSF043L04+ CTCGGTCCTTTCTGTTCATTTCCTGTACGGCAATCCTACGCATGCTCTCAACAACATCCA
JMSF048O13+ CTCGGTCCTTTCTGTTCATTTCCTGTACGGCAATCCTACGCATGCTCTCAACAACATCCA
rJMSF043L04- CTCGGTCCTTTCTGTTCATTTCCTGTACGGCAATCCTACGCATGCTCTCAACAACATCCA
                      ____________________________________________________________
consensus CTCGGTCCTTTCTGTTCATTTCCTGTACGGCAATCCTACGCATGCTCTCAACAACATCCA
 
. : . : . : . : . : . :
rJMFF040N11- CGTTTACAAGCTTCCGCTTCTTCCCAATAAGCCACCCTTTAGGGTAACTCGAGGAGTCGA
JMFF011C02+ CGTTTACAAGCTTCCGCTTCTTCCCAATAAGCCACCCTTTAGGGTAACTCGAGGAGTCGA
rJMSF048O13- CGTTTACAAGCTTCCGCTTCTTCCCAATAAGCCACTCTTTAGGGTAACTCGAGGAGTCGA
JMSF043L04+ CGTTTACAAGCTTCCGCTTCTTCCCAATAAGCCACTCTTTAGGGTAACTCGAGGAGTCGA
JMSF048O13+ CGTTTACAAGCTTCCGCTTCTTCCCAATAAGCCACTCTTTAGGGTAACTCGAGGAGTCGA
rJMSF043L04- CGTTTACAAGCTTCCGCTTCTTCCCAATAAGCCACTCTTTAGGGTAACTCGAGGAGTCGA
                      ____________________________________________________________
consensus CGTTTACAAGCTTCCGCTTCTTCCCAATAAGCCACTCTTTAGGGTAACTCGAGGAGTCGA
 
. : . : . : . : . : . :
rJMFF040N11- AATCAGGTGGGGGTAACAACGACTCGGCTGATGGTCTTTTGCCACTCGCATTTGTTATGG
JMFF011C02+ AATCAGGTGGGGGTAACAACGACTCGGCTGATGGTCTTTTGCCACTCGCATTTGTTATGG
rJMSF048O13- AATCAGGTGGGGGTAACAACGACTCGGCTGATGGTCTTTTGCCACTCGCATTTGTTATGG
JMSF043L04+ AATCAGGTGGGGGTAACAACGACTCGGCTGATGGTCTTTTGCCACTCGCATTTGTTATGG
JMSF048O13+ AATCAGGTGGGGGTAACAACGACTCGGCTGATGGTCTTTTGCCACTCGCATTTGTTATGG
rJMSF043L04- AATCAGGTGGGGGTAACAACGACTCGGCTGATGGTCTTTTGCCACTCGCATTTGTTATGG
                      ____________________________________________________________
consensus AATCAGGTGGGGGTAACAACGACTCGGCTGATGGTCTTTTGCCACTCGCATTTGTTATGG
 
. : . : . : . : . : . :
rJMFF040N11- GTTCCAATGGTTCAAACAAGGCCTTTCTGCGCTCAGAAAGAACAGAAAGTGCATCCACAT
JMFF011C02+ GTTCCAATGGTTCAAACAAGGCCTTTCTGCGCTCAGAAAGAACAGAAAGTGCATCCACAT
rJMSF048O13- GTTCCAATGGTTCAAACAAGGCCTTTCTGCGCTCAGAAAGAACAGAAAGTGCATCCACAT
JMSF043L04+ GTTCCAATGGTTCAAACAAGGCCTTTCTGCGCTCAGAAAGAACAGAAAGTGCATCCACAT
JMSF048O13+ GTTCCAATGGTTCAAACAAGGCCTTTCTGCGCTCAGAAAGAACAGAAAGTGCATCCACAT
rJMSF043L04- GTTCCAATGGTTCAAACAAGGCCTTTCTGCGCTCAGAAAGAACAGAAAGTGCATCCACAT
                      ____________________________________________________________
consensus GTTCCAATGGTTCAAACAAGGCCTTTCTGCGCTCAGAAAGAACAGAAAGTGCATCCACAT
 
. : . : . : . : . : . :
rJMFF040N11- CCATTTCCTCCTTTTTCTCATCACCCGACAATTCTTCCTGCTGTTTCTCTGGCGTTTTCT
JMFF011C02+ CCATTTCCTCCTTTTTCTCATCACCCGACAATTCTTCCTGCTGTTTCTCTGGCGTTTTCT
rJMSF048O13- CCATTTCCTCCTTTTTCTCATCACCCGACAATTCTTCCTGCTGTTTCTCTGGCGTTTTCT
JMSF043L04+ CCATTTCCTCCTTTTTCTCATCACCCGACAATTCTTCCTGCTGTTTCTCTGGCGTTTTCT
JMSF048O13+ CCATTTCCTCCTTTTTCTCATCACCCGACAATTCTTCCTGCTGTTTCTCTGGCGTTTTCT
rJMSF043L04- CCATTTCCTCCTTTTTCTCATCACCCGACAATTCTTCCTGCTGTTTCTCTGGCGTTTTCT
                      ____________________________________________________________
consensus CCATTTCCTCCTTTTTCTCATCACCCGACAATTCTTCCTGCTGTTTCTCTGGCGTTTTCT
 
. : . : . : . : . : . :
rJMFF040N11- CATCCGTTACACTGTCCAACTTCTTCCCACTGACTG
JMFF011C02+ CATCCGTTACACTGTCCAACTTCTTCCCACTGACTG
rJMSF048O13- CATCCGTTACACTGTCCAACTTCTTCCCACTGACTGATCTTTTCCGGGATTTCCAGAAAA
JMSF043L04+ CATCCGTTACACTGTCCAACTTCTTCCCACTGACTG
JMSF048O13+ CATCCGTTACACTGTCCAACTTCTTCCCACTGACTG
rJMSF043L04- CATCCGTTACACTGTCCAACTTCTTCCCACTGACTGATCTTTTCCGGGATTTCCAGAAAA
                      ____________________________________________________________
consensus CATCCGTTACACTGTCCAACTTCTTCCCACTGACTGATCTTTTCCGGGATTTCCAGAAAA
 
. : . : . : . : . : . :
rJMSF048O13- CTGGAGTAGAAGGCACGTGGGAGAAGCCATTCAAAGTCTCCATGTCCATGGCCATGGGGG
rJMSF043L04- CTGGAGTAGAAGGCACGTGGGAGAAGCCATTCAAAGTCTCCATGTCCATGGCCATGGGGG
                      ____________________________________________________________
consensus CTGGAGTAGAAGGCACGTGGGAGAAGCCATTCAAAGTCTCCATGTCCATGGCCATGGGGG
 
. : . : . : . : . : . :
rJMSF048O13- TCTTCTCTGTAGACTCCTTCATT
rJMSF043L04- TCTTCTCTGTAGACTCCTTCATTGAAAAAACTGCAAATTTCTGTCAAGAAAACACCAAAA
                      ____________________________________________________________
consensus TCTTCTCTGTAGACTCCTTCATTGAAAAAACTGCAAATTTCTGTCAAGAAAACACCAAAA