Previous Contig 013499:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF043K19Sequence770020193gb:CSA549290_16738472e-78Crocus sativus mRNA for aldehyde dehydrogenase (adh gene).731013499 (2)gb:AF348412_17900893e-75Zea mays cytosolic aldehyde dehydrogenase RF2C (rf2c) gene, complete cds.
JMSF046E08Sequence136013499 (2)gb:AF348413_17900900.003Zea mays cytosolic aldehyde dehydrogenase RF2C (rf2c) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF043K19- GACATATAGAT
                      ____________________________________________________________
consensus GACATATAGAT
 
. : . : . : . : . : . :
rJMSF043K19- AGATAGATAGAGTTGTTCTCCATTCCCCTGACTATTACATGGAAAGAATCTTCAAGCTTT
                      ____________________________________________________________
consensus AGATAGATAGAGTTGTTCTCCATTCCCCTGACTATTACATGGAAAGAATCTTCAAGCTTT
 
. : . : . : . : . : . :
JMSF046E08+ TAGAGTGAAAAATGCCATTTTATTA
rJMSF043K19- GCGGTTCTCTCTAGCTCTGAGGATTGTTTTAGAAGTAGAGTGAAAAATGCCATTTTATTA
                      ____________________________________________________________
consensus GCGGTTCTCTCTAGCTCTGAGGATTGTTTTAGAAGTAGAGTGAAAAATGCCATTTTATTA
 
. : . : . : . : . : . :
JMSF046E08+ CAGAATGTAGAGCAGAAAAGTTTAGAGCCATGGAGAATTGTAAACTGGGGTGGCAACAGA
rJMSF043K19- CAGAATGTAGAGCAGAAAAGTTTAGAGCCATGGAGAATTGTAAACTGGGGTGGCAACAGA
                      ____________________________________________________________
consensus CAGAATGTAGAGCAGAAAAGTTTAGAGCCATGGAGAATTGTAAACTGGGGTGGCAACAGA
 
. : . : . : . : . : . :
JMSF046E08+ TTTAAGTTGAAGGTACTTGTAAAGGCCTTCCATCCCCAT
rJMSF043K19- TTTAAGTTGAAGGTACTTGTAAAGGCCTTCCATCCCCATATCTTTATCAAACCCACTCAT
                      ____________________________________________________________
consensus TTTAAGTTGAAGGTACTTGTAAAGGCCTTCCATCCCCATATCTTTATCAAACCCACTCAT
 
. : . : . : . : . : . :
rJMSF043K19- TTTATACCCTCCAAACGGGCAGTCTGCATCAAAAGCCAGATAACAATTGATCCAAATAAT
                      ____________________________________________________________
consensus TTTATACCCTCCAAACGGGCAGTCTGCATCAAAAGCCAGATAACAATTGATCCAAATAAT
 
. : . : . : . : . : . :
rJMSF043K19- GCCTGCTCTTATTGATCTTGAAACTGTGTTAGCAATGTTCCAGTCATTCGTCATAATTCC
                      ____________________________________________________________
consensus GCCTGCTCTTATTGATCTTGAAACTGTGTTAGCAATGTTCCAGTCATTCGTCATAATTCC
 
. : . : . : . : . : . :
rJMSF043K19- TGCAGCTAGTCCATATTTTGTGTCATTAGCCCTCTTTATCACCTCCTCCACTGTCTTGAA
                      ____________________________________________________________
consensus TGCAGCTAGTCCATATTTTGTGTCATTAGCCCTCTTTATCACCTCCTCCACTGTCTTGAA
 
. : . : . : . : . : . :
rJMSF043K19- TTTGAGTATAGGCATAACAGGTCCAAAAATTTCATCTTTTGCAATTAGCATGTCATCCGT
                      ____________________________________________________________
consensus TTTGAGTATAGGCATAACAGGTCCAAAAATTTCATCTTTTGCAATTAGCATGTCATCCGT
 
. : . : . : . : . : . :
rJMSF043K19- GACATCTGTAAATATAGTTGGCTCAATGAAATAGCCTTTTCTGTCCAGTGGCTTACCACC
                      ____________________________________________________________
consensus GACATCTGTAAATATAGTTGGCTCAATGAAATAGCCTTTTCTGTCCAGTGGCTTACCACC
 
. : . : . : . : . : . :
rJMSF043K19- AGTTAGCAATGTAGCACCCTCCCTCTTTCCATGCTCAATATATGAAAGTATCTTCTCATA
                      ____________________________________________________________
consensus AGTTAGCAATGTAGCACCCTCCCTCTTTCCATGCTCAATATATGAAAGTATCTTCTCATA
 
. : . : . : . : . : . :
rJMSF043K19- CTGATTTATGTCAGCTTGGGGTCCCTGTTGAACATTAGGATCAAAAGGGTCGCCAATCAC
                      ____________________________________________________________
consensus CTGATTTATGTCAGCTTGGGGTCCCTGTTGAACATTAGGATCAAAAGGGTCGCCAATCAC
 
. : . : . : . : . : . :
rJMSF043K19- CCTGGCTTTTGCCTTGGCTACCACCTTCTCAACAAACTTGTCATAAATTCCCTTCCTGAA
                      ____________________________________________________________
consensus CCTGGCTTTTGCCTTGGCTACCACCTTCTCAACAAACTTGTCATAAATTCCCTTCCTGAA