Previous Contig 013486:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027P16Sequence526013486 (4)gb:OSJN00002_16930879e-49Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0018M05, complete seque581012427 (3)gb:AB005242_15095032e-48Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQK4.>gb:AF503764_18067
JMSF025J24Sequence508013486 (4)gb:OSJN00002_16930873e-41Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0018M05, complete seque725012427 (3)gb:AB005242_15095039e-76Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQK4.>gb:AF503764_18067
JMSF034B21Sequence631013486 (4)gb:OSJN00002_16930873e-49Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0018M05, complete seque714012427 (3)gb:AB005242_15095036e-83Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQK4.>gb:AF503764_18067
JMSF043I13Sequence794008090 (2)gb:AY088440_15734592e-85Arabidopsis thaliana clone 6694 mRNA, complete sequence.727013486 (4)gb:OSJN00002_16930875e-49Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0018M05, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF027P16+ CGG
JMSF034B21+ CCGTCGGAAACTCCTCGTCGG
rJMSF043I13+ CGG
                      ____________________________________________________________
consensus CCGTCGGAAACTCCTCGTCGG
 
. : . : . : . : . : . :
JMFF027P16+ TTATCAGAACCAGCGCCGGGCGCGGCGATTCCGCCGGAAACATGGACAGAGCCTCCATCA
JMSF034B21+ TTATCAGAACCAGCGCCGGGCGCGGCGATTCCGCCGGAAACATGGACAGAGCCTCCATCA
rJMSF043I13+ TTATCAGAACCAGCGCCGGGCGCGGCGATTCCGCCGGAAACATGGACAGAGCCTCCATCA
                      ____________________________________________________________
consensus TTATCAGAACCAGCGCCGGGCGCGGCGATTCCGCCGGAAACATGGACAGAGCCTCCATCA
 
. : . : . : . : . : . :
JMFF027P16+ GCACATCCTTCGACAAGCAGTCAACGAAGATCACCTTCGACTCGCAGTGGCGGAGCATAA
JMSF034B21+ GCACATCCTTCGACAAGCAGTCAACGAAGATCACCTTCGACTCGCAGTGGCGGAGCATAA
JMSF025J24+ CGCAGTGGCGGAGCATAA
rJMSF043I13+ GCACATCCTTCGACAAGCAGTCAACGAAGATCACCTTCGACTCGCAGTGGCGGAGCATAA
                      ____________________________________________________________
consensus GCACATCCTTCGACAAGCAGTCAACGAAGATCACCTTCGACTCGCAGTGGCGGAGCATAA
 
. : . : . : . : . : . :
JMFF027P16+ TCGACACCGTGCGAGCATCCAGCCGGAGATTGATGGAGTTGAGCACGGCTCCCGCCATGG
JMSF034B21+ TCGACACCGTGCGAGCATCCAGCCGGAGATTGATGGAGTTGAGCACGGCTCCCGCCATGG
JMSF025J24+ TNGACACCGTGCGAGCATCCAGCCGGAGATTGATGGAGTTGAGCNCGGCTCCCGCCATGG
rJMSF043I13+ TCGACACCGTGCGAGCATCCAGCCGGAGATTGATGGAGTTGAGCACGGCTCCCGCCATGG
                      ____________________________________________________________
consensus TCGACACCGTGCGAGCATCCAGCCGGAGATTGATGGAGTTGAGCACGGCTCCCGCCATGG
 
. : . : . : . : . : . :
JMFF027P16+ GCACGGCGAAGTTCATCTCGTACATGGCCGGAATATTGGGCGCCATCACAGACACCACCT
JMSF034B21+ GCACGGCGAAGTTCATCTCGTACATGGCCGGAATATTGGGCGCCATCACAGACACCACCT
JMSF025J24+ GCACGGCGAAGTTCATCTCGTACATGGCCGGAATATTGGGCGCCATCACAGACACCACCT
rJMSF043I13+ GCACGGCGAAGTTCATCTCGTACATGGCCGGAATATTGGGCGCCATCACAGACACCACCT
                      ____________________________________________________________
consensus GCACGGCGAAGTTCATCTCGTACATGGCCGGAATATTGGGCGCCATCACAGACACCACCT
 
. : . : . : . : . : . :
JMFF027P16+ GCCCTCTCTCAACCCCAAGGCCCACAATCGCCGACGCCAGACGGAGGCAACGCCGGTGGG
JMSF034B21+ ACCCTCTCTCAACCCCAAGGCCCACAATCGCCGACGCCAGACGGAGGCAACGCCGGTGGG
JMSF025J24+ GCCCTCTCTCAACCCCAAGGCCCACAATCGCCGACGCCAGACGGAGGCAACGCCGGTGGG
rJMSF043I13+ GCCCTCTCTCAACCCCAAGGCCCACAATCGCCGACGCCAGGCGGAGGCAACGCCGGTGGG
                      ____________________________________________________________
consensus GCCCTCTCTCAACCCCAAGGCCCACAATCGCCGACGCCAGACGGAGGCAACGCCGGTGGG
 
. : . : . : . : . : . :
JMFF027P16+ TCTCCGACCACGTATACGCCGTGCCGTTGTAGACGACGGAAGTACAGTCGCCGTAGATGG
JMSF034B21+ TCTCCGACCACGTATACGCCGTGCCGTTGTAGACGACGGAAGTACAGTCGCCGTAGATGG
JMSF025J24+ TCTCCGACCANGTATACGCCGTGCCGTTGTAGACGACGGAAGTACAGTCGCCGTAGATGG
rJMSF043I13+ TCTCCGACCACGTATACGCCGTGCCGTTGTAGACGACGGAAGTACAGTCGCCGTAGATGG
                      ____________________________________________________________
consensus TCTCCGACCACGTATACGCCGTGCCGTTGTAGACGACGGAAGTACAGTCGCCGTAGATGG
 
. : . : . : . : . : . :
JMFF027P16+ TGGCCGTTCTCTCCAAGAAGTTCAGTGGTGTCAGCGGGCAAGAATTCGCCGGACTTAGCT
JMSF034B21+ TGGCCGTTCTCTCCAAGAAGTTCAGTGGTGTCAGCGGGCAAGAATTCGCCGGACTTAGCT
JMSF025J24+ TGGCCGTTCTCTCCAAGAAGTTCAGTGGTGTCAGCGGGCAAGAATTCGCCGGACTTAGCT
rJMSF043I13+ TGGCCGTTCTCTCCAAGAAGTTCAGTGGTGTCAGCGGGCAAGAATTCGCCGGACTTAGCT
                      ____________________________________________________________
consensus TGGCCGTTCTCTCCAAGAAGTTCAGTGGTGTCAGCGGGCAAGAATTCGCCGGACTTAGCT
 
. : . : . : . : . : . :
JMFF027P16+ TCAGTTGATCCATTGCAACCGCTTTTTGGATTCACAGTCAGCTCAAAACTGCTTTAAATC
JMSF034B21+ TCAGTTGATCCATTGCAACCGCTTTTTGGATTCACAGTCAGCTCAAAACTGCTTTAAATC
JMSF025J24+ TCAGTTGATCCATTGCAACCGCTTTTNGGATTCACAGTCAGCTCAAAACTGCTTTAAATC
rJMSF043I13+ TCAGTTGATCCATTGCAACCGCTTTTTGGATTCACAGTCAGCTCAAAACTGCTTTAAATC
                      ____________________________________________________________
consensus TCAGTTGATCCATTGCAACCGCTTTTTGGATTCACAGTCAGCTCAAAACTGCTTTAAATC
 
. : . : . : . : . : . :
JMFF027P16+ TGTAAAAAGATTATGATCGACGGAGAAGATCAAGAGGAAAGGT
JMSF034B21+ TGTAAAAAGATTATGATCGACGGAGAAGATCAAGAGGAAAGGTATTACAATCTAACACGT
JMSF025J24+ TGTAAAAAGATTATGATCGACGGAGAAGATCAAGAGGAAAGGTATTACAATNTAACACGT
rJMSF043I13+ TGTAAAAAGATTATGATCGACGGAGAAGATCAAGAGGAAAGGTATTACAATCTAACACGT
                      ____________________________________________________________
consensus TGTAAAAAGATTATGATCGACGGAGAAGATCAAGAGGAAAGGTATTACAATCTAACACGT
 
. : . : . : . : . : . :
JMSF034B21+ ATGATCTTTCATATAATATTTCAATTCGTCCTTATCCCAATTGCGAATAAGGACATGCGT
JMSF025J24+ ATGATCTTTCATATAATATTTCAATTCGTCCTTATCCCAATTGCGAATAAGGACATGCGT
rJMSF043I13+ ATGATCTTTCATATAATATTTCAATTCGTCCTTATCCCAATTGCGAATAAGGACATGCGT
                      ____________________________________________________________
consensus ATGATCTTTCATATAATATTTCAATTCGTCCTTATCCCAATTGCGAATAAGGACATGCGT
 
. : . : . : . : . : . :
JMSF034B21+ TCAGTGT
JMSF025J24+ TCAGTGT
rJMSF043I13+ TCAGTGTTTGGTTATTATTTGTTCATTTCCTCTCCTTAAATATGGCAGGATCAGAATATC
                      ____________________________________________________________
consensus TCAGTGTTTGGTTATTATTTGTTCATTTCCTCTCCTTAAATATGGCAGGATCAGAATATC
 
. : . : . : . : . : . :
rJMSF043I13+ TACTACATACCATTACTGTAGTTTTCTTTTTTAAATTTAGAAAAATTTTCTACTCAACAT
                      ____________________________________________________________
consensus TACTACATACCATTACTGTAGTTTTCTTTTTTAAATTTAGAAAAATTTTCTACTCAACAT