Previous Contig 013480:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF043F24Sequence723013480 (2)gb:AC129718_17406425e-29Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0088I06, complet798013480 (2)gb:AC129718_17406422e-15Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0088I06, complet

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043F24- GGACATCAGCCATTGGTTCCTTTAGGGCCAAAACTC
                      ____________________________________________________________
consensus GGACATCAGCCATTGGTTCCTTTAGGGCCAAAACTC
 
. : . : . : . : . : . :
JMSF043F24- AAAAGCAATAGCCATGGCGACGCTAGCCACACTATCTCTCTGCTGCCCGACCTCACATTC
                      ____________________________________________________________
consensus AAAAGCAATAGCCATGGCGACGCTAGCCACACTATCTCTCTGCTGCCCGACCTCACATTC
 
. : . : . : . : . : . :
JMSF043F24- ACCACTCCATTGTTCTTCAACCAAACCCAATTCTCTCCATTTCACCACACCCAAGAAGAG
                      ____________________________________________________________
consensus ACCACTCCATTGTTCTTCAACCAAACCCAATTCTCTCCATTTCACCACACCCAAGAAGAG
 
. : . : . : . : . : . :
JMSF043F24- AAGCTCTTCCCACAGTCAAAGGAGGTTTAGAGTTTTGGCCGTCACAGAGGGCTCTGCTAA
                      ____________________________________________________________
consensus AAGCTCTTCCCACAGTCAAAGGAGGTTTAGAGTTTTGGCCGTCACAGAGGGCTCTGCTAA
 
. : . : . : . : . : . :
JMSF043F24- GAACACAAGCAAAGAAGGAGAAGAAGACCCTTCAGTTCCCTCTTGGGCCAAACCCGGGTC
rJMSF043F24+ TTGGGCCAACCCCGGGTC
                      ____________________________________________________________
consensus GAACACAAGCAAAGAAGGAGAAGAAGACCCTTCAGTTCCCTCTTGGGCCAACCCCGGGTC
 
. : . : . : . : . : . :
JMSF043F24- AGAAGAGCCG-CCCCCGTGGG-CCAGAAATGAGT-CCCAGAAAGATTCTTCCAGCTTTGA
rJMSF043F24+ AGAAGAGCCGCCCCCCGTGGGNCCAGAAATGAGTCCCCAGAAAGATTCTTCCAGCTTTGA
                      ____________________________________________________________
consensus AGAAGAGCCGCCCCCCGTGGGNCCAGAAATGAGTCCCCAGAAAGATTCTTCCAGCTTTGA
 
. : . : . : . : . : . :
JMSF043F24- GGTTCCCTTCTATGTGTATCTTCTGGCCTCAGCTATCACTGCCATTGCTGCTATCGGTTC
rJMSF043F24+ GGTTCCCTTCTATGTGTATCTTCTGGCCTCAGCTATCACTGCCATTGCTGCTATCGGTTC
                      ____________________________________________________________
consensus GGTTCCCTTCTATGTGTATCTTCTGGCCTCAGCTATCACTGCCATTGCTGCTATCGGTTC
 
. : . : . : . : . : . :
JMSF043F24- GATTTTTGAGTATGTGAATCAAAAACCCGTTTTTGGAGTTGTGAGCCCCGATAGTGCATT
rJMSF043F24+ GATTTTTGAGTATGTGAATCAAAAACCCGTTTTTGGAGTTGTGAGCCCCGATAGTGCATT
                      ____________________________________________________________
consensus GATTTTTGAGTATGTGAATCAAAAACCCGTTTTTGGAGTTGTGAGCCCCGATAGTGCATT
 
. : . : . : . : . : . :
JMSF043F24- TTATGCTCCTCTACTTGGGTTCTTTGTTTTCACAGGCATTCCCACTTCTGTAAGTCTTTC
rJMSF043F24+ TTATGCTCCTCTACTTGGGTTCTTTGTTTTCACAGGCATTCCCACTTCTGTAAGTCTTTC
                      ____________________________________________________________
consensus TTATGCTCCTCTACTTGGGTTCTTTGTTTTCACAGGCATTCCCACTTCTGTAAGTCTTTC
 
. : . : . : . : . : . :
JMSF043F24- ATTTTCTCTAGTTATCCTTGTGACCTTGCTAATGGGTTTCTGCAAAATTTTTGTGTTCCT
rJMSF043F24+ ATTTTCTCTAGTTATCCTTGTGACCTTGCTAATGGGTTTCTGCAAAATTTTTGTGTTCCT
                      ____________________________________________________________
consensus ATTTTCTCTAGTTATCCTTGTGACCTTGCTAATGGGTTTCTGCAAAATTTTTGTGTTCCT
 
. : . : . : . : . : . :
JMSF043F24- AGTTTTGCCTTTTAGTTTAGTTGGTTCTGTTAATCTTTCAAATGATCAAATTTTAAAAAG
rJMSF043F24+ AGTTTTGCCTTTTAGTTTAGTTGGTTCTGTTAATCTTTCAAATGATCAAATTTTAAAAAG
                      ____________________________________________________________
consensus AGTTTTGCCTTTTAGTTTAGTTGGTTCTGTTAATCTTTCAAATGATCAAATTTTAAAAAG
 
. : . : . : . : . : . :
JMSF043F24- TTGGAATGTATGAATGGTATGATAAATGTCTGGAAAGTTGTATCCCTTTTCCCATGTCAA
rJMSF043F24+ TTGGAATGTATGAATGGTATGATAAATGTCTGGAAAGTTGTATCCCTTTTCCCATGTCAA
                      ____________________________________________________________
consensus TTGGAATGTATGAATGGTATGATAAATGTCTGGAAAGTTGTATCCCTTTTCCCATGTCAA
 
. : . : . : . : . : . :
JMSF043F24- TCCATGAAAAAACAAATGTGACAATCTAGC
rJMSF043F24+ TCCATGAAAAAACAAATGTGACAATCTAGCTTAGGTTTTATTGAAGCTACATGAGCACAA
                      ____________________________________________________________
consensus TCCATGAAAAAACAAATGTGACAATCTAGCTTAGGTTTTATTGAAGCTACATGAGCACAA
 
. : . : . : . : . : . :
rJMSF043F24+ ATGCATAGATAATTTGGTTGAAAAGAATGTTAAATCCAGGGATTTCTTTGGTTCAAATCG
                      ____________________________________________________________
consensus ATGCATAGATAATTTGGTTGAAAAGAATGTTAAATCCAGGGATTTCTTTGGTTCAAATCG
 
. : . : . : . : . : . :
rJMSF043F24+ GTTCAAGCCGCTAACAAGGAGGCAGATGAGCAAGACAAGAGGGATGGGTATCTTTAGATT
                      ____________________________________________________________
consensus GTTCAAGCCGCTAACAAGGAGGCAGATGAGCAAGACAAGAGGGATGGGTATCTTTAGATT
 
. : . : . : . : . : . :
rJMSF043F24+ CTTTGTTACTCACTTGTACAATGTACTTGGTTCGAGTTGTATCTACTTGTAAAGATTTTT
                      ____________________________________________________________
consensus CTTTGTTACTCACTTGTACAATGTACTTGGTTCGAGTTGTATCTACTTGTAAAGATTTTT
 
. : . : . : . : . : . :
rJMSF043F24+ GCACAGCGGCTCTGGGATTATTTCGTTGTGCAAGCTAGCTATGCTAATATATCATCATTG
                      ____________________________________________________________
consensus GCACAGCGGCTCTGGGATTATTTCGTTGTGCAAGCTAGCTATGCTAATATATCATCATTG
 
. : . : . : . : . : . :
rJMSF043F24+ TCATCACAATCTGAAACCTCATAATGTAACTCATACATGAATACTGTTTTGCCTCCTTCT
                      ____________________________________________________________
consensus TCATCACAATCTGAAACCTCATAATGTAACTCATACATGAATACTGTTTTGCCTCCTTCT