Previous Contig 013478:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF043C12Sequence693013478 (3)gb:AC149267_17448792e-04Solanum demissum chromosome 5 clone PGEC747E24 map MAP_LOC, complete sequence.761024018gb:AC087551_17340711e-07Oryza sativa (japonica cultivar-group) chromosome 5 clone P0431G05, complete seq
JMSF043F13Sequence731013478 (3)gb:AB040742_15196404e-06Oryza sativa RRJ2 premature mRNA for pyruvate decarboxylase, partial cds.>gb:AC1755013478 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043F13- GGGGGAGTAGTCA
                      ____________________________________________________________
consensus GGGGGAGTAGTCA
 
. : . : . : . : . : . :
JMSF043F13- ACGGAACTGAAACCCTTTTGCATCCCCATTTCTTACCATCCGATCTTTAAGCATCTTAGT
                      ____________________________________________________________
consensus ACGGAACTGAAACCCTTTTGCATCCCCATTTCTTACCATCCGATCTTTAAGCATCTTAGT
 
. : . : . : . : . : . :
JMSF043F13- GTGAGGTTGAAGTCACCAGGGACGGCGAAGACGTCACTCACCCCTATCTGCACAAGGTGG
                      ____________________________________________________________
consensus GTGAGGTTGAAGTCACCAGGGACGGCGAAGACGTCACTCACCCCTATCTGCACAAGGTGG
 
. : . : . : . : . : . :
JMSF043F13- TGAGCGAGGTGGCGACAGACTGTAGCAGGGATTCGTGGATCAAAGAGTGGATATGAAAAT
                      ____________________________________________________________
consensus TGAGCGAGGTGGCGACAGACTGTAGCAGGGATTCGTGGATCAAAGAGTGGATATGAAAAT
 
. : . : . : . : . : . :
JMSF043F13- GCCTTCTCGATGCAATTAGGGCTCAATTTTAAAAAATCCTACCTATTTCTGGCAAGGCGC
JMSF043C12+ TGGCAAGGCGC
                      ____________________________________________________________
consensus GCCTTCTCGATGCAATTAGGGCTCAATTTTAAAAAATCCTACCTATTTCTGGCAAGGCGC
 
. : . : . : . : . : . :
JMSF043F13- ACATCGGATCGTTAGAATCAAGGAATGTGCTCATCAAATTTACTGAAGAAATCGATTGTA
JMSF043C12+ ACATCGGATCGTTAGAATCAAGGAATGTGCTCATCAAATTTACTGAAGAAATCGATTGTA
                      ____________________________________________________________
consensus ACATCGGATCGTTAGAATCAAGGAATGTGCTCATCAAATTTACTGAAGAAATCGATTGTA
 
. : . : . : . : . : . :
JMSF043F13- CATGAATTTTGGCGAAAGGCAGAGTAGAAATCGAAGGAAAATGGGCCAAGTTCGCTCGTT
JMSF043C12+ CATGAATTTTGGCGAAAGGCAGAGTAGAAATCGAAGGAAAATGGGCCAAGTTCGCTCGTT
                      ____________________________________________________________
consensus CATGAATTTTGGCGAAAGGCAGAGTAGAAATCGAAGGAAAATGGGCCAAGTTCGCTCGTT
 
. : . : . : . : . : . :
JMSF043F13- GGTCGCCGGATTAGAGTTCGAAGAGAGATTTACCGTTCGCAGCCATATGGCTTAAGTTGC
JMSF043C12+ GGTCGCCGGATTAGAGTTCGAAGAGAGATTTACCGTTCGCAGCCATATGGCTTAAGTTGC
                      ____________________________________________________________
consensus GGTCGCCGGATTAGAGTTCGAAGAGAGATTTACCGTTCGCAGCCATATGGCTTAAGTTGC
 
. : . : . : . : . : . :
JMSF043F13- CAAAATTGCCTTATCATCTTTTTGATCCACGGTTCGTCGAACAAGGCCAAGTACGGCTCG
JMSF043C12+ CAAAATTGCCTTATCATCTTTTTGATCCACGGTTCGTCGAACAAGGCCAAGTACGGCTCG
                      ____________________________________________________________
consensus CAAAATTGCCTTATCATCTTTTTGATCCACGGTTCGTCGAACAAGGCCAAGTACGGCTCG
 
. : . : . : . : . : . :
JMSF043F13- AGTGAAGGTGGAGTTGGATTTGCTTCAGGATCAGGATGAAAAGATTTGGATTGAGGTCGT
JMSF043C12+ AGTGAAGGTGGAGTTGGATTTGCTTCAGGATCAGGATGAAAAGATTTGGATTGAGGTCGT
                      ____________________________________________________________
consensus AGTGAAGGTGGAGTTGGATTTGCTTCAGGATCAGGATGAAAAGATTTGGATTGAGGTCGT
 
. : . : . : . : . : . :
JMSF043F13- GAATCAGGAAGGAGAAGTGCGTGGATTTGGCAGAGGATTGAGTATGAACACATTCCTAAA
JMSF043C12+ GAATCAGGAAGGAGAAGTGCGTGGATTTGGCAGAGGATTGAGTATGAACACATTCCTAAA
                      ____________________________________________________________
consensus GAATCAGGAAGGAGAAGTGCGTGGATTTGGCAGAGGATTGAGTATGAACACATTCCTAAA
 
. : . : . : . : . : . :
JMSF043F13- TTCTGTAGCGATTGTAGGCGATTTGGTCACCTGCTGCTTGAATGTCGTCGAAATCGAGGA
JMSF043C12+ TTCTGTAGCGATTGTAGGCGATTTGGTCACCTGCTGCTTGAATGTCGTCGAAATCGAGGA
                      ____________________________________________________________
consensus TTCTGTAGCGATTGTAGGCGATTTGGTCACCTGCTGCTTGAATGTCGTCGAAATCGAGGA
 
. : . : . : . : . : . :
JMSF043F13- AATTGGCCGCCAACGGTGTTGACGGAGAAGAGAGATGAGGGTGGCAGAGTCATAGCAG
JMSF043C12+ AATTGGCCGCCAACGGTGTTGACGGAGAAGAGAGATGAGGGTGGCAGAGTCATAGCAGAG
rJMSF043F13+ AGAAGAGAGATGAGGGTGGCAGAGTCATAGCAGAG
                      ____________________________________________________________
consensus AATTGGCCGCCAACGGTGTTGACGGAGAAGAGAGATGAGGGTGGCAGAGTCATAGCAGAG
 
. : . : . : . : . : . :
JMSF043C12+ GTGGAGGTGGATCGTTGGAGTGAGACGCTGCCGGCTGAGAGAGAGTTGGAAACCGCTGCC
rJMSF043F13+ GNGGAGGTGGATCGTTGGAGTGAGACGCTGCCGGCTGAGAGAGAGTTGGAAACCGCTGCC
                      ____________________________________________________________
consensus GTGGAGGTGGATCGTTGGAGTGAGACGCTGCCGGCTGAGAGAGAGTTGGAAACCGCTGCC
 
. : . : . : . : . : . :
JMSF043C12+ TGCTTGCCGATCTAGAGGCGAGTGAAGAGGTCTCTAATGAACAGTGCTAAATCTTCCGGG
rJMSF043F13+ TGCTTGCCGATCTAGAGGCGAGTGAAGAGGTCTNTAATGAACAGTGNTAAATCTTCCGGG
                      ____________________________________________________________
consensus TGCTTGCCGATCTAGAGGCGAGTGAAGAGGTCTCTAATGAACAGTGCTAAATCTTCCGGG
 
. : . : . : . : . : . :
JMSF043C12+ TGGAGGTAGAGGACCGGGAGGGGGGAGAGAGAGAGGACAATAGCCGTGGACTCCCCATTT
rJMSF043F13+ TGGAGGTAGAGGACCGGGAGGGGGGAGAGAGAGAGGACAATAGCCGTGGACTCCCCATTT
                      ____________________________________________________________
consensus TGGAGGTAGAGGACCGGGAGGGGGGAGAGAGAGAGGACAATAGCCGTGGACTCCCCATTT
 
. : . : . : . : . : . :
JMSF043C12+ TACCCTTTTAGTTTGATCG
rJMSF043F13+ TACCCTTTTAGTTTGATCGNCAAATTACNCTAAGGATCATTTCGGGTAAAAAGAACAATC
                      ____________________________________________________________
consensus TACCCTTTTAGTTTGATCGNCAAATTACNCTAAGGATCATTTCGGGTAAAAAGAACAATC
 
. : . : . : . : . : . :
rJMSF043F13+ GGAGNTAAATTGAAGAATTTTGAAAATTAAAGNCCAAATTGGTGAAATTNTCATAGTCGA
                      ____________________________________________________________
consensus GGAGNTAAATTGAAGAATTTTGAAAATTAAAGNCCAAATTGGTGAAATTNTCATAGTCGA
 
. : . : . : . : . : . :
rJMSF043F13+ GGGNCCAAATCGGTAATTAACTCATCCTTTTTGGTTTCCCTCCTGTTATAGCNCTAGCTT
                      ____________________________________________________________
consensus GGGNCCAAATCGGTAATTAACTCATCCTTTTTGGTTTCCCTCCTGTTATAGCNCTAGCTT
 
. : . : . : . : . : . :
rJMSF043F13+ TNTGGCATGTCATCATCACAATTCACAAAAAGCACAAACCCTCTGGTCAAAAGGCAGATG
                      ____________________________________________________________
consensus TNTGGCATGTCATCATCACAATTCACAAAAAGCACAAACCCTCTGGTCAAAAGGCAGATG
 
. : . : . : . : . : . :
rJMSF043F13+ AATAACAGATTTGTGAGAGGCCTCAACCCTCCCCTTCCCCACATTACATAATACATATTC
                      ____________________________________________________________
consensus AATAACAGATTTGTGAGAGGCCTCAACCCTCCCCTTCCCCACATTACATAATACATATTC
 
. : . : . : . : . : . :
rJMSF043F13+ AGAAAAAAGGNGNGACAACNCAGAGCTGAAGAAGCTTCTCATGTCATAGNTACACAAAAG
                      ____________________________________________________________
consensus AGAAAAAAGGNGNGACAACNCAGAGCTGAAGAAGCTTCTCATGTCATAGNTACACAAAAG
 
. : . : . : . : . : . :
rJMSF043F13+ GCATCACTATTTTCTTGGTAAGCAATTCTCTCCTAACCTCTCTCATTCTTTACTGTTCTG
                      ____________________________________________________________
consensus GCATCACTATTTTCTTGGTAAGCAATTCTCTCCTAACCTCTCTCATTCTTTACTGTTCTG
 
. : . : . : . : . : . :
rJMSF043F13+ NGCATGCATTCTNTTCCNTTCCAATTTTTTTTTTGATTCTCAAGTTTTGCAGTCTCAGAA
                      ____________________________________________________________
consensus NGCATGCATTCTNTTCCNTTCCAATTTTTTTTTTGATTCTCAAGTTTTGCAGTCTCAGAA
 
. : . : . : . : . : . :
rJMSF043F13+ CATTAATGGAGTAGAAAGAAGAAAGAAGAAATGTCTGCACACAAAAACAATATTATATAT
                      ____________________________________________________________
consensus CATTAATGGAGTAGAAAGAAGAAAGAAGAAATGTCTGCACACAAAAACAATATTATATAT