Previous Contig 013472:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF038E21Sequence463013472 (4)gb:AC092781_17357472e-26Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.840013152 (2)gb:AB011479_15114492e-05Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNA5.
JMSF038H01Sequence466013472 (4)gb:AC092781_17357472e-26Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.875013152 (2)gb:AB011479_15114492e-05Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNA5.
JMSF043E18Sequence828013989 (5)gb:AB104727_1526539e-121Arabidopsis thaliana At-SPS2 mRNA for solanesyl diphosphate synthase, complete c418013472 (4)gb:AC092781_17357478e-27Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.
JMSF050L01Sequence643013989 (5)gb:AB071514_15228832e-95Arabidopsis thaliana At SPS mRNA for solanesyl diphosphate synthase, complete cd392013472 (4)gb:AC092781_17357478e-27Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038H01+ TNTTTTTTTCTAAAATAACACCGTAATATCTCTCAAAAAACACTGTAATAAAT
JMSF038E21+ TTTTTTCTAAAATAACACTGTAATATCTCTCAAAAAACACTGTAATAAAT
                      ____________________________________________________________
consensus TNTTTTTTTCTAAAATAACACTGTAATATCTCTCAAAAAACACTGTAATAAAT
 
. : . : . : . : . : . :
JMSF038H01+ ACTACAAATACAAATAAACATTTAATCAAAGCAAAATATAGGGCAAATTTTCAAAGACAC
rJMSF050L01- AGCAAAATNTAGGGCAAATTTTCTAAGACAC
JMSF038E21+ ACTACAAATACAAATAAACATTTAATCAAAGCAAAATATAGGGCAAATTTTCAAAGACAC
                      ____________________________________________________________
consensus ACTACAAATACAAATAAACATTTAATCAAAGCAAAATATAGGGCAAATTTTCAAAGACAC
 
. : . : . : . : . : . :
JMSF038H01+ AACAAAAAGCATTGTTCCAAAGATCAATCCAGGTTTAACAGAACTAAATAAAGAACATCA
rJMSF050L01- AACAAAAAGCATTGTTCCAAAGATCAATCCAGGTTTAACAGAACTAAATAAAGAACATCA
JMSF038E21+ AACAAAAAGCATTGTTCCAAAGATCAATCCAGGTTTAACAGAACTAAATAAAGAACATCA
                      ____________________________________________________________
consensus AACAAAAAGCATTGTTCCAAAGATCAATCCAGGTTTAACAGAACTAAATAAAGAACATCA
 
. : . : . : . : . : . :
JMSF038H01+ TGCCCATCAAATCGTCTCTAGATCAAAATACTCCCTTCACTAACAAACAACAAGAAGGCC
rJMSF050L01- TGCCCATCAAATCGTCTCTAGATCAAAATACTCCCTTCACTAACAAACAACAAGAAGGCC
JMSF038E21+ TGCCCATCAAATCGTCTCTAGATCAAAATACTCCCTTCACTAACAAACAACAAGAAGGCC
                      ____________________________________________________________
consensus TGCCCATCAAATCGTCTCTAGATCAAAATACTCCCTTCACTAACAAACAACAAGAAGGCC
 
. : . : . : . : . : . :
JMSF038H01+ TTCAATCCATTAGCGGTACTTTATGAACCCGATTTCTTTGGCATTGCTGCGGAAGCACTG
rJMSF050L01- TTCAATCCATTAGCGGTACTTTATGAACCCGATTTCTTTGGCATTGCTGCGGAAGCACTG
JMSF038E21+ TTCAATCCATTAGCGGTACTTTATGAACCCGATTTCTTTGGCATTGCTGCGGAAGCACTG
rJMSF043E18- AGCGGTACTTTATGAACCCGATTTCTTTGGCATTGCTGCGGAAGCACTG
                      ____________________________________________________________
consensus TTCAATCCATTAGCGGTACTTTATGAACCCGATTTCTTTGGCATTGCTGCGGAAGCACTG
 
. : . : . : . : . : . :
JMSF038H01+ TCTGCAGCACATAAGGCCATACCTTCTGATAATTCCATGAGAATTCCCACACACACGGCA
rJMSF050L01- TCTGCAGCACATAAGGCCATACTTTCTGATAATTCCATGAGAATTCCCACACACACGGCA
JMSF038E21+ TCTGCAGCACATAAGGCCATACCTTCTGATAATTCCATGAGAATTCCCACACACACGGCA
rJMSF043E18- TCTGCAGCACATAAGGCCATACTTTCTGATAATTCCATGAGAATTCCCACACACACGGCA
                      ____________________________________________________________
consensus TCTGCAGCACATAAGGCCATACTTTCTGATAATTCCATGAGAATTCCCACACACACGGCA
 
. : . : . : . : . : . :
JMSF038H01+ TGCGCGTGATCCAGGTCCATAGGTCTTAGGGTGAGCGTTCCAGATGTTTGAGTGACCCAT
rJMSF050L01- TGCGCGTGATCCAGGTCCATAGGTCTTAGGGTGAGCGTTCCAGATGTTTGAGTGACCCAT
JMSF038E21+ TGCGCGTGATCCAGGTCCATAGGTCTTAGGGTGAGCGTTCCAGATGTTTGAGTGACCCAT
rJMSF043E18- TGCGCGTGATCCAGGTCCATAGGTCTTAGGGTGAGCGTTCCAGATGTTTGAGTGACCCAT
                      ____________________________________________________________
consensus TGCGCGTGATCCAGGTCCATAGGTCTTAGGGTGAGCGTTCCAGATGTTTGAGTGACCCAT
 
. : . : . : . : . : . :
JMSF038H01+ GACTACCTTGGATTCAGCTGCCGCTTCTGAGTTCTGAAACAATGAAAACGG
rJMSF050L01- G
JMSF038E21+ GACTACCTTGGATTCAGCTGCCGCTTCTGAGTTCTGAAACAATGAAAACGG
rJMSF043E18- GACTACCTTGGATTCAGCTGCCGCTTCTGAGTTCTGAAACAATGAAAACGGGTCGTGATG
                      ____________________________________________________________
consensus GACTACCTTGGATTCAGCTGCCGCTTCTGAGTTCTGAAACAATGAAAACGGGTCGTGATG