Previous Contig 013470:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017F17Sequence821013470 (5)pir|G84697|G846971e-90hypothetical protein At2g29560 [imported] - Arabidopsis thaliana>gb:AC004561_153
JMFF021P12Sequence433013470 (5)pir|G84697|G846972e-22hypothetical protein At2g29560 [imported] - Arabidopsis thaliana>gb:AC004561_153
JMSF012M15Sequence737013470 (5)pir|G84697|G846977e-75hypothetical protein At2g29560 [imported] - Arabidopsis thaliana>gb:AC004561_153
JMSF021I17Sequence688002221 (2)pir|G84697|G846972e-97hypothetical protein At2g29560 [imported] - Arabidopsis thaliana>gb:AC004561_153748013470 (5)pir|G84697|G846974e-76hypothetical protein At2g29560 [imported] - Arabidopsis thaliana>gb:AC004561_153
JMSF043E07Sequence782013470 (5)pir|G84697|G846972e-73hypothetical protein At2g29560 [imported] - Arabidopsis thaliana>gb:AC004561_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017F17+ AAAATCAAGATAGCTATTGATGCCGCTGCTACTGAGTTTT
                      ____________________________________________________________
consensus AAAATCAAGATAGCTATTGATGCCGCTGCTACTGAGTTTT
 
. : . : . : . : . : . :
rJMFF017F17+ GTATAGGCACAAAGTATGATTTGGATTTTAAAACTCCAAATAGATCTGGGCAAAATTTTA
rJMSF012M15+ TTA
rJMSF021I17+ AAATTTTA
rJMSF043E07+ TTA
                      ____________________________________________________________
consensus GTATAGGCACAAAGTATGATTTGGATTTTAAAACTCCAAATAGATCTGGGCAAAATTTTA
 
. : . : . : . : . : . :
rJMFF017F17+ AGTCAGGAGAGAATATGGTCGAGATGTACAGAGAACTCTGTACAGGCTATCCGATTGTAT
rJMSF012M15+ AGTCAGGAGAGAATATGGTCGAGATGTACAGAGAACTCTGTACAGGCTATCCGATTGTAT
rJMSF021I17+ AGTCAGGAGAGAATATGGTCGAGATGTACAGAGAACTCTGTACAGGCTATCCGATTGTAT
rJMSF043E07+ AGTCAGGAGAGAATATGGTCGAGATGTACAGAGAACTCTGTACAGGCTATCCGATTGTAT
                      ____________________________________________________________
consensus AGTCAGGAGAGAATATGGTCGAGATGTACAGAGAACTCTGTACAGGCTATCCGATTGTAT
 
. : . : . : . : . : . :
rJMFF017F17+ CAATTGAAGATCCGTTTGACAAAGAAGACTGGGAACATACAAAATATTTTTCTGGCCTTG
rJMSF012M15+ CAATTGAAGATCCGTTTGACAAAGAAGACTGGGAACATACAAAATATTTTTCTGGCCTTG
rJMSF021I17+ CAATTGAAGATCCGTTTGACAAAGAAGACTGGGAACATACAAAATATTTTTCTGGCCTTG
rJMSF043E07+ CAATTGAAGATCCGTTTGACAAAGAAGACTGGGAACATACAAAATATTTTTCTGGCCTTG
                      ____________________________________________________________
consensus CAATTGAAGATCCGTTTGACAAAGAAGACTGGGAACATACAAAATATTTTTCTGGCCTTG
 
. : . : . : . : . : . :
rJMFF017F17+ GAATATGCCAGGTAGTTGGAGATGACTTATTAATGTCTAATCCTAAACGAATTGAGAGAG
rJMSF012M15+ GAATATGCCAGGTAGTTGGAGATGACTTATTAATGTCTAATCCTAAACGAATTGAGAGAG
rJMSF021I17+ GAATATGCCAGGTAGTTGGAGATGACTTATTAATGTCTAATCCTAAACGAATTGAGAGAG
rJMSF043E07+ GAATATGCCAGGTAGTTGGAGATGACTTATTAATGTCTAATCCTAAACGAATTGAGAGAG
                      ____________________________________________________________
consensus GAATATGCCAGGTAGTTGGAGATGACTTATTAATGTCTAATCCTAAACGAATTGAGAGAG
 
. : . : . : . : . : . :
rJMFF017F17+ CCATTCAGGAGAATGCGTGTAATGCCCTTCTTCTCAAGGTTAATCAGATTGGGACTGTGA
rJMSF012M15+ CCATTCAGGAGAATGCGTGTAATGCCCTTCTTCTCAAGGTTAATCAGATTGGGACTGTGA
rJMSF021I17+ CCATTCAGGAGAATGCGTGTAATGCCCTTCTTCTCAAGGTTAATCAGATTGGGACTGTGA
rJMSF043E07+ CCATTCAGGAGAATGCGTGTAATGCCCTTCTTCTCAAGGTTAATCAGATTGGGACTGTGA
                      ____________________________________________________________
consensus CCATTCAGGAGAATGCGTGTAATGCCCTTCTTCTCAAGGTTAATCAGATTGGGACTGTGA
 
. : . : . : . : . : . :
rJMFF021P12+ GGGGAGTGGTGGNNTCCC
rJMFF017F17+ CTGAAGCTATTGAAGTAGTGAAGATGGCTAAGGATGCCAATTGGGGAGTGGTGGTATCCC
rJMSF012M15+ CTGAAGCTATTGAAGTAGTGAAGATGGCTAAGGATGCCAATTGGGGAGTGGTGGTATCCC
rJMSF021I17+ CTGAAGCTATTGAAGTAGTGAAGATGGCTAAGGATGCCAATTGGGGAGTGGTGGTATCCC
rJMSF043E07+ CTGAAGCTATTGAAGTAGTGAAGATGGCTAAGGATGCCAATTGGGGAGTGGTGGTATCCC
                      ____________________________________________________________
consensus CTGAAGCTATTGAAGTAGTGAAGATGGCTAAGGATGCCAATTGGGGAGTGGTGGTATCCC
 
. : . : . : . : . : . :
rJMFF021P12+ AAAGAAGTGGTGAAACTGAGGACNCTTTCATAGCTGATTTATCTGTTGGCATGGCCNCAG
rJMFF017F17+ AAAGAAGTGGTGAAACTGAGGACACTTTCATAGCTGATTTATCTGTTGGCATGGCCACAG
rJMSF012M15+ AAAGAAGTGGTGAAACTGAGGACACTTTCATAGCTGATTTATCTGTTGGCATGGCCACAG
rJMSF021I17+ AAAGAAGTGGTGAAACTGAGGACACTTTCATAGCTGATTTATCTGTTGGCATGGCCACAG
rJMSF043E07+ AAAGAAGTGGTGAAACTGAGGACACTTTCATAGCTGATTTATCTGTTGGCATGGCCACAG
                      ____________________________________________________________
consensus AAAGAAGTGGTGAAACTGAGGACACTTTCATAGCTGATTTATCTGTTGGCATGGCCACAG
 
. : . : . : . : . : . :
rJMFF021P12+ GTCAGATTAAAGCAGGAGCGCCTTGCCGTGGAGAGCGACTGGCTAAGTACAATCAGTTGA
rJMFF017F17+ GTCAGATTAAAGCAGGAGCGCCTTGCCGTGGAGAGCGACTGGCTAAGTACAATCAGTTGA
rJMSF012M15+ GTCAGATTAAAGCAGGAGCGCCTTGCCGTGGAGAGCGACTGGCTAAGTACAATCAGTTGA
rJMSF021I17+ GTCAGATTAAAGCAGGAGCGCCTTGCCGTGGAGAGCGACTGGCTAAGTACAATCAGTTGA
rJMSF043E07+ GTCAGATTAAAGCAGGAGCGCCTTGCCGTGGAGAGCGACTGGCTAAGTACAATCAGTTGA
                      ____________________________________________________________
consensus GTCAGATTAAAGCAGGAGCGCCTTGCCGTGGAGAGCGACTGGCTAAGTACAATCAGTTGA
 
. : . : . : . : . : . :
rJMFF021P12+ TTAGAATTGAAGAGGAGCTTGGTGAACAAGCAGTTTACGTTGGTCAGGACTGGAGGCGCT
rJMFF017F17+ TTAGAATTGAAGAGGAGCTTGGTGAACAAGCAGTTTACGTTGGTCAGGACTGGAGGCGCT
rJMSF012M15+ TTAGAATTGAAGAGGAGCTTGGTGAACAAGCAGTTTACGTTGGTCAGGACTGGAGGCGCT
rJMSF021I17+ TTAGAATTGAAGAGGAGCTTGGTGAACAAGCAGTTTACGTTGGTCAGGACTGGAGGCGCT
rJMSF043E07+ TTAGAATTGAAGAGGAGCTTGGTGAACAAGCAGTTTACGTTGGTCAGGACTGGAGGCGCT
                      ____________________________________________________________
consensus TTAGAATTGAAGAGGAGCTTGGTGAACAAGCAGTTTACGTTGGTCAGGACTGGAGGCGCT
 
. : . : . : . : . : . :
rJMFF021P12+ GTTGATCATCTTCATCGTTTTATACTAGCAAATTTTGTCCCATCTGTCAACAAAGTCAAA
rJMFF017F17+ GTTGATCATCTTCATCGTTTTATACTAGCAAATTTTGTCCCATCTGTCAACAAAGTCAAA
rJMSF012M15+ GTTGATCATCTTCATCGTTTTATACTAGCAGATTTTGTCCCATCTGTCAACAAAGTCAAA
rJMSF021I17+ GTTGATCATCTTCATCGTTTTATACTAGCAAATTTTGTCCCATCTGTCAACAAAGTCAAA
rJMSF043E07+ GTTGATCATCTTCATCGTTTTATACTAGCAAATTTTGTCCCATCTGTCAACAAAGTCAAA
                      ____________________________________________________________
consensus GTTGATCATCTTCATCGTTTTATACTAGCAAATTTTGTCCCATCTGTCAACAAAGTCAAA
 
. : . : . : . : . : . :
rJMFF021P12+ GTAATGCAATTGTGCTCATACATAAGCAACCGTTGTTCTTTGCTTGCATGTTTGTCACTG
rJMFF017F17+ GTAATGCAATTGTGCTCATACATAAGCAACCGTTGTTCTTTGCTTGCATGTTTGTCACTG
rJMSF012M15+ GTAATGCAATTGTGCTCATACATAAGCAACCGTTGTTCTTTGCTTGCATGTTTGTCACTG
rJMSF021I17+ GTAATGCAATTGTGCTCATACATAAGCAACCGTTGTTCTTTGCTTGCATGTTTGTCACTG
rJMSF043E07+ GTAATGCAATTGTGCTCATACATAAGCAACCGTTGTTCTTTGCTTGCATGTTTGTCACTG
                      ____________________________________________________________
consensus GTAATGCAATTGTGCTCATACATAAGCAACCGTTGTTCTTTGCTTGCATGTTTGTCACTG
 
. : . : . : . : . : . :
rJMFF021P12+ CATCCAACAATTCTTGAATAGAATGTGAAGATTTAAAGGGCTCACAAAACAGGAGTGCAG
rJMFF017F17+ CATCCAACAATTCTTGAATAGAATGTGAAGATTTAAAGGGCTCACAAAACAGGAGTGCAG
rJMSF012M15+ CATCCAACAATTCTTGAATAGAATGTGAAGATTTAAAGGGCTCACAAAACAGGAGTGCAG
rJMSF021I17+ CATCCAACAATTCTTGAATAGAATGTGAAGATTTAAAGGGCTCACAAAACAGGAGTGCAG
rJMSF043E07+ CATCCAACAATTCTTGAATAGAATGTGAAGATTTAAAGGGCTCACAAAACAGGAGTGCAG
                      ____________________________________________________________
consensus CATCCAACAATTCTTGAATAGAATGTGAAGATTTAAAGGGCTCACAAAACAGGAGTGCAG
 
. : . : . : . : . : . :
rJMFF021P12+ AACCAAAAAAATTTTCTTTGATCAGATGTTGATGA-CTTTGTATCATTTATT
rJMFF017F17+ AACCAAAAAAATTTTCTTTGATCAGATGTTGATGA-CTTTGTATCATTTATTTGGCTACT
rJMSF012M15+ AACCAAAAAAATTTTCTTTGATCAGATGTTGATGACCTTTGTATCATTTATTTGGCTACT
rJMSF021I17+ AACCAAAAAAATTTTCTTTGATCAGATGTTGATGA-CTTTGTATCATTTATTTGGCTACT
rJMSF043E07+ AACCAAAAAAATTTTCTTTGATCAGATGTTGATGA-CTTTGTATCATTTATTTGGCTACT
                      ____________________________________________________________
consensus AACCAAAAAAATTTTCTTTGATCAGATGTTGATGA-CTTTGTATCATTTATTTGGCTACT
 
. : . : . : . : . : . :
rJMFF017F17+ TT
rJMSF012M15+ TT
rJMSF021I17+ TTTGTCAAT
rJMSF043E07+ TTTGTCAATTAGAAATTAATATGGGATCAAAATTTAAATTCAACCCCATTTGTGAGCTGA
                      ____________________________________________________________
consensus TTTGTCAATTAGAAATTAATATGGGATCAAAATTTAAATTCAACCCCATTTGTGAGCTGA