Previous Contig 013467:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF043D17Sequence814013467 (2)gb:AP004768_18447093e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P001839013467 (2)gb:AC024081_15392652e-23Arabidopsis thaliana chromosome III P1 MJK13 genomic sequence, complete sequence

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043D17- GTTGGAGAGCGTGGGACG
                      ____________________________________________________________
consensus GTTGGAGAGCGTGGGACG
 
. : . : . : . : . : . :
JMSF043D17- CTGAATACTAAAGTCTACAGTTCGCAGAGGTGAAGGAGAAGAAAGGAAGCTTTGCTCGCT
                      ____________________________________________________________
consensus CTGAATACTAAAGTCTACAGTTCGCAGAGGTGAAGGAGAAGAAAGGAAGCTTTGCTCGCT
 
. : . : . : . : . : . :
JMSF043D17- CAAGATGATGAAAATGGAAATGCTTCCTTCAAACTTTTCTTATGGTGATGAGGACCGTAA
                      ____________________________________________________________
consensus CAAGATGATGAAAATGGAAATGCTTCCTTCAAACTTTTCTTATGGTGATGAGGACCGTAA
 
. : . : . : . : . : . :
JMSF043D17- GAATCTTCAGCAGCTGCTTGAAGCATTTGGTTCTGTCGTTTCACTTGAAGATATTGCTTC
                      ____________________________________________________________
consensus GAATCTTCAGCAGCTGCTTGAAGCATTTGGTTCTGTCGTTTCACTTGAAGATATTGCTTC
 
. : . : . : . : . : . :
JMSF043D17- AGCTTATTGTAAAGCAGGTCGCGATCCTTCTATTGCTGGTGACATAATCTGCAATCTGCA
                      ____________________________________________________________
consensus AGCTTATTGTAAAGCAGGTCGCGATCCTTCTATTGCTGGTGACATAATCTGCAATCTGCA
 
. : . : . : . : . : . :
JMSF043D17- AGCTAGCACATCTACAACTTCAAGTTCTGAGAATACAGAGAAGAGTGACACACTTCACAA
                      ____________________________________________________________
consensus AGCTAGCACATCTACAACTTCAAGTTCTGAGAATACAGAGAAGAGTGACACACTTCACAA
 
. : . : . : . : . : . :
JMSF043D17- TGATGTTGAGGAATTTCTGTTTAAAATGCTTGGAGATGGCTTTTCACTCAATATGAGTAC
                      ____________________________________________________________
consensus TGATGTTGAGGAATTTCTGTTTAAAATGCTTGGAGATGGCTTTTCACTCAATATGAGTAC
 
. : . : . : . : . : . :
JMSF043D17- AATCCACAATGTTGTTGGTCAATGTGGATTTGATGTGAACAAGAGTATGGAGTCACTCAT
                      ____________________________________________________________
consensus AATCCACAATGTTGTTGGTCAATGTGGATTTGATGTGAACAAGAGTATGGAGTCACTCAT
 
. : . : . : . : . : . :
JMSF043D17- AGATTTGTCAGCAGCAACTTTGGAGAAGTCTGATGATATTGTCAGCATAGATTCTGAAGA
                      ____________________________________________________________
consensus AGATTTGTCAGCAGCAACTTTGGAGAAGTCTGATGATATTGTCAGCATAGATTCTGAAGA
 
. : . : . : . : . : . :
JMSF043D17- ATTTCCAAATCTGAAATCAAATTCATCTCGAGATTCTGCTGAAAGTTCCAAAAGGACCAA
                      ____________________________________________________________
consensus ATTTCCAAATCTGAAATCAAATTCATCTCGAGATTCTGCTGAAAGTTCCAAAAGGACCAA
 
. : . : . : . : . : . :
JMSF043D17- AACAAATAACACAGCTGCAGATGAACTTCAGTTACAAAAGATGAAAAGGAAAAATGAACT
                      ____________________________________________________________
consensus AACAAATAACACAGCTGCAGATGAACTTCAGTTACAAAAGATGAAAAGGAAAAATGAACT
 
. : . : . : . : . : . :
JMSF043D17- TCAAAAAGAAATTTTACAGTCATTGTTTTCTCACCCTGGAAGATATGATGATGAAGTAGT
                      ____________________________________________________________
consensus TCAAAAAGAAATTTTACAGTCATTGTTTTCTCACCCTGGAAGATATGATGATGAAGTAGT
 
. : . : . : . : . : . :
JMSF043D17- AGCTCGACCTTCAAAGGAATCTCGGAGAAGTAGATTTGTTGTTGATAAACCGCTAGAATT
                      ____________________________________________________________
consensus AGCTCGACCTTCAAAGGAATCTCGGAGAAGTAGATTTGTTGTTGATAAACCGCTAGAATT
 
. : . : . : . : . : . :
JMSF043D17- ACCAGAGATAGAACATCGCACTGTCATTATAAGACCTCATGTTACCCAAATGAATGATGA
rJMSF043D17+ CCAGAGATAGAACATCGCACTGTCATTATAAGACCTCATGTTACCCAAATGAATGATGA
                      ____________________________________________________________
consensus ACCAGAGATAGAACATCGCACTGTCATTATAAGACCTCATGTTACCCAAATGAATGATGA
 
. : . : . : . : . : . :
JMSF043D17- TGATGATGATGATAAT
rJMSF043D17+ TGATGATGATGATAATGAGGAAAGTTATGAAGTTNTGCGAGAAGCAGTAAAGGAGCACTG
                      ____________________________________________________________
consensus TGATGATGATGATAATGAGGAAAGTTATGAAGTTNTGCGAGAAGCAGTAAAGGAGCACTG
 
. : . : . : . : . : . :
rJMSF043D17+ GACTACAATGAAAGAGTACTATAAGGCTGCTATTGAGGCATTTGTTAAAGAAGACCGCGT
                      ____________________________________________________________
consensus GACTACAATGAAAGAGTACTATAAGGCTGCTATTGAGGCATTTGTTAAAGAAGACCGCGT
 
. : . : . : . : . : . :
rJMSF043D17+ AAGAGCATACAGGCTTCTAGAGGAGGGAAATTTTTTTATGAAGAAGGCTCGGGAAGCAGA
                      ____________________________________________________________
consensus AAGAGCATACAGGCTTCTAGAGGAGGGAAATTTTTTTATGAAGAAGGCTCGGGAAGCAGA
 
. : . : . : . : . : . :
rJMSF043D17+ TGAAAAGTCTGCTCAAAAGCTTCTTCAACCCAGATATAAGTGTGAAGAGTTGTCCTTTGA
                      ____________________________________________________________
consensus TGAAAAGTCTGCTCAAAAGCTTCTTCAACCCAGATATAAGTGTGAAGAGTTGTCCTTTGA
 
. : . : . : . : . : . :
rJMSF043D17+ TGTGCACCATTTTGCGCCAAAAGATGCAATTGACTTTCTGAAAGGGCAGTTCAATACTTA
                      ____________________________________________________________
consensus TGTGCACCATTTTGCGCCAAAAGATGCAATTGACTTTCTGAAAGGGCAGTTCAATACTTA
 
. : . : . : . : . : . :
rJMSF043D17+ TGTGGGACTCCCACTTCCACCTTTCCAGTGCTTTCGTGTGATTGTTGGGGTCAATGATGA
                      ____________________________________________________________
consensus TGTGGGACTCCCACTTCCACCTTTCCAGTGCTTTCGTGTGATTGTTGGGGTCAATGATGA
 
. : . : . : . : . : . :
rJMSF043D17+ TGATGCCACCAATGGACCTCGGAAGCGTTTGGTTGCAAAGTATTTCGATAAACGCTCAAT
                      ____________________________________________________________
consensus TGATGCCACCAATGGACCTCGGAAGCGTTTGGTTGCAAAGTATTTCGATAAACGCTCAAT
 
. : . : . : . : . : . :
rJMSF043D17+ ACCATGGACAGAGGAAGAGAATGGAAAGGTTTTGGTGATCAAGGTGGAGGATATAGATCG
                      ____________________________________________________________
consensus ACCATGGACAGAGGAAGAGAATGGAAAGGTTTTGGTGATCAAGGTGGAGGATATAGATCG
 
. : . : . : . : . : . :
rJMSF043D17+ CCAGAAACTGACTTCTTACAAAAGCGTACCCAGAAACTGAGTTTTTCCAAAAGCATTACC
                      ____________________________________________________________
consensus CCAGAAACTGACTTCTTACAAAAGCGTACCCAGAAACTGAGTTTTTCCAAAAGCATTACC
 
. : . : . : . : . : . :
rJMSF043D17+ GGCAGCATGCCATAAGCTTCACCAACTTTGTTGTCCTGTATCCTAAACTAAAATTTGAAC
                      ____________________________________________________________
consensus GGCAGCATGCCATAAGCTTCACCAACTTTGTTGTCCTGTATCCTAAACTAAAATTTGAAC
 
. : . : . : . : . : . :
rJMSF043D17+ ATTTTTGGATGGCTATCTGATTGAAAACTTTGGAATTCAAAATTCGGATATCCACTCCGG
                      ____________________________________________________________
consensus ATTTTTGGATGGCTATCTGATTGAAAACTTTGGAATTCAAAATTCGGATATCCACTCCGG
 
. : . : . : . : . : . :
rJMSF043D17+ CCCCATGAGAACTGTAGTTTCTTTCTCTTTTTGCCTGTGCAATACAGCCATATGGCAGTA
                      ____________________________________________________________
consensus CCCCATGAGAACTGTAGTTTCTTTCTCTTTTTGCCTGTGCAATACAGCCATATGGCAGTA
 
. : . : . : . : . : . :
rJMSF043D17+ TTGCCAGAGACCTTAAGTTATTTGTAATGGTGACATTTTGCCTTCCTTGGCCAAACTGAC
                      ____________________________________________________________
consensus TTGCCAGAGACCTTAAGTTATTTGTAATGGTGACATTTTGCCTTCCTTGGCCAAACTGAC