Previous Contig 013466:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029N10Sequence595013466 (6)gb:OSJN00127_16953374e-64Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K01, complete seque735013466 (6)gb:OSJN00127_16953377e-64Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K01, complete seque
JMFF038K05Sequence496013466 (6)gb:OSJN00127_16953372e-62Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K01, complete seque753013466 (6)gb:OSJN00127_16953375e-63Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K01, complete seque
JMSF043D15Sequence751013466 (6)gb:OSJN00127_16953377e-64Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K01, complete seque689013466 (6)gb:OSJN00127_16953376e-64Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K01, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF038K05- ATTCCCCCGTGAACTGTCGTGAAAGTTCTAGCTTCATCGCAAAACCACTC
JMFF029N10- ATTCCCCCGTGAACTGTCGTGAAAGTTCTAGCTTCATCGCAAAACCACTC
rJMFF038K05+ GTCGTGAAAGTTCTAGCTTCATCGCAAAACCACTC
rJMFF029N10+ CTAGCTTCATCGCAAAACCACTC
JMSF043D15- GTCGTGAAAGTTCTAGCTTCATCGCAAAACCACTC
                      ____________________________________________________________
consensus ATTCCCCCGTGAACTGTCGTGAAAGTTCTAGCTTCATCGCAAAACCACTC
 
. : . : . : . : . : . :
JMFF038K05- GCCGGTTTCATATACGCGGCTACCTGTCCCCAATCTCGACTT-GTTTCTTTGGACCGGAT
JMFF029N10- GCCGGTTTCATATACGCGGCTACCTGTCCCCAATCTCGACTT-GTTTCTTTGGACCGGAT
rJMFF038K05+ GCCGGTTTCATATACGCGGCTACCTGTCCCCAATCTCGACTT-GTTTCTTTGGACCGGAT
rJMFF029N10+ GCCGGTTTCATATACGCGGCTACCTGTCCCCAATCTCGACTT-GTTTCTTTGGACCGGAT
JMSF043D15- GCCGGTTTCATATACGCGGCTACCTGTCCCCAATCTCGACTT-GTTTCTTTGGACCGGAT
rJMSF043D15+ AATCTCGACTTGGTTTCTTTGGACCGGAT
                      ____________________________________________________________
consensus GCCGGTTTCATATACGCGGCTACCTGTCCCCAATCTCGACTT-GTTTCTTTGGACCGGAT
 
. : . : . : . : . : . :
JMFF038K05- CCTCAACAGCTGCTACGATTTTGAGGTTTTACATCAGCTTGGGTATAAAACGGTCTTGCT
JMFF029N10- CCTCAACAGCTGCTACGATTTTGAGGTTTTACATCAGCTTGGGTATAAAACGGTCTTGCT
rJMFF038K05+ CCTCAACAGCTGCTACGATTTTGAGGTTTTACATCAGCTTGGGTATAAAACGGTCTTGCT
rJMFF029N10+ CCTCAACAGCTGCTACGATTTTGAGGTTTTACATCAGCTTGGGTATAAAACGGTCTTGCT
JMSF043D15- CCTCAACAGCTGCTACGATTTTGAGGTTTTACATCAGCTTGGGTATAAAACGGTCTTGCT
rJMSF043D15+ CCTCAACAGCTGCTACGATTTTGAGGTTTTACATCAGCTTGGGTATAAAACGGTCTTGCT
                      ____________________________________________________________
consensus CCTCAACAGCTGCTACGATTTTGAGGTTTTACATCAGCTTGGGTATAAAACGGTCTTGCT
 
. : . : . : . : . : . :
JMFF038K05- GGAAGTATGGCCAAGCACCATCCTGATCTGATCATGTGCAGGAAGCAGCCAGGAATAGCC
JMFF029N10- GGAAGTATGGCCAAGCACCATCCTGATCTGATCATGTGCAGGAAGCAGCCAGGAATAGCC
rJMFF038K05+ GGAAGTATGGCCAAGCACCATCCTGATCTGATCATGTGCAGGAAGCAGCCAGGAATAGCC
rJMFF029N10+ GGAAGTATGGCCAAGCACCATCCTGATCTGATCATGTGCAGGAAGCAGCCAGGAATAGCC
JMSF043D15- GGAAGTATGGCCAAGCACCATCCTGATCTGATCATGTGCAGGAAGCAGCCAGGAATAGCC
rJMSF043D15+ GGAAGTATGGCCAAGCACCATCCTGATCTGATCATGTGCAGGAAGCAGCCAGGAATAGCC
                      ____________________________________________________________
consensus GGAAGTATGGCCAAGCACCATCCTGATCTGATCATGTGCAGGAAGCAGCCAGGAATAGCC
 
. : . : . : . : . : . :
JMFF038K05- ATTGGACGGCTTTGTGAGAAATGTGATGGGAAATGTGTCATTTGTGATTCTTACGTTCGG
JMFF029N10- ATTGGACGGCTTTGTGAGAAATGTGATGGGAAATGTGTCATTTGTGATTCTTACGTTCGG
rJMFF038K05+ ATTGGACGGCTTTGTGAGAAATGTGATGGGAAATGTGTCATTTGTGATTCTTACGTTCGG
rJMFF029N10+ ATTGGACGGCTTTGTGAGAAATGTGATGGGAAATGTGTCATTTGTGATTCTTACGTTCGG
JMSF043D15- ATTGGACGGCTTTGTGAGAAATGTGATGGGAAATGTGTCATTTGTGATTCTTACGTTCGG
rJMSF043D15+ ATTGGACGGCTTTGTGAGAAATGTGATGGGAAATGTGTCATTTGTGATTCTTACGTTCGG
                      ____________________________________________________________
consensus ATTGGACGGCTTTGTGAGAAATGTGATGGGAAATGTGTCATTTGTGATTCTTACGTTCGG
 
. : . : . : . : . : . :
JMFF038K05- CCTTGTACACTTGTTCGTGTGTGCGATGAATGCAACTATGGTTCTTTTCAGGGTCGCTGT
JMFF029N10- CCTTGTACACTTGTTCGTGTGTGCGATGAATGCAACTATGGTTCTTTTCAGGGTCGCTGT
rJMFF038K05+ CCTTGTACACTTGTTCGTGTGTGCGATGAATGCAACTATGGTTCTTTTCAGGGTCGCTGT
rJMFF029N10+ CCTTGTACACTTGTTCGTGTGTGCGATGAATGCAACTATGGTTCTTTTCAGGGTCGCTGT
JMSF043D15- CCTTGTACACTTGTTCGTGTGTGCGATGAATGCAACTATGGTTCTTTTCAGGGTCGCTGT
rJMSF043D15+ CCTTGTACACTTGTTCGTGTGTGCGATGAATGCAACTATGGTTCTTTTCAGGGTCGCTGT
                      ____________________________________________________________
consensus CCTTGTACACTTGTTCGTGTGTGCGATGAATGCAACTATGGTTCTTTTCAGGGTCGCTGT
 
. : . : . : . : . : . :
JMFF038K05- GTCATCTGTGGAGGGGTTGGGATTTCTGATGCTTACTACTGTAAGGAGTGTACTCAGCAG
JMFF029N10- GTCATCTGTGGAGGGGTTGGGATTTCTGATGCTTACTACTGTAAGGAGTGTACTCAGCAG
rJMFF038K05+ GTCATCTGTGGAGGGGTTGGGATTTCTGATGCTTACTACTGTAAGGAGTGTACTCAGCAG
rJMFF029N10+ GTCATCTGTGGAGGGGTTGGGATTTCTGATGCTTACTACTGTAAGGAGTGTACTCAGCAG
JMSF043D15- GTCATCTGTGGAGGGGTTGGGATTTCTGATGCTTACTACTGTAAGGAGTGTACTCAGCAG
rJMSF043D15+ GTCATCTGTGGAGGGGTTGGGATTTCTGATGCTTACTACTGTAAGGAGTGTACTCAGCAG
                      ____________________________________________________________
consensus GTCATCTGTGGAGGGGTTGGGATTTCTGATGCTTACTACTGTAAGGAGTGTACTCAGCAG
 
. : . : . : . : . : . :
JMFF038K05- GAGAAAGATCGTGATGGTTGTCCTAAAATTGTCAATCTTGGAAGTGCCAAAACTGATCTC
JMFF029N10- GAGAAAGATCGTGATGGTTGTCCTAAAATTGTCAATCTTGGAAGTGCCAAAACTGATCTC
rJMFF038K05+ GAGAAAGATCGTGATGGTTGTCCTAAAATTGTCAATCTTGGAAGTGCCAAAACTGATCTC
rJMFF029N10+ GAGAAAGATCGTGATGGTTGTCCTAAAATTGTCAATCTTGGAAGTGCCAAAACTGATCTC
JMSF043D15- GAGAAAGATCGTGATGGTTGTCCTAAAATTGTCAATCTTGGAAGTGCCAAAACTGATCTC
rJMSF043D15+ GAGAAAGATCGTGATGGTTGTCCTAAAATTGTCAATCTTGGAAGTGCCAAAACTGATCTC
                      ____________________________________________________________
consensus GAGAAAGATCGTGATGGTTGTCCTAAAATTGTCAATCTTGGAAGTGCCAAAACTGATCTC
 
. : . : . : . : . : . :
JMFF038K05- TTCTACGAGCGTAAAAAATATGGTTTC
JMFF029N10- TTCTACGAGCGTAAAAAATATGGTTTCAAGAAAAGATGATTGCTGCTCCAAAGAAATAAT
rJMFF038K05+ TTNTACGAGCGTAAAAAATATGGTTTCAAGAAAAGATGATTGCTGCTCCAAAGAAATAAT
rJMFF029N10+ TTCTACGAGCGTAAAAAATATGGTTTCAAGAAAAGATGATTGCTGCTCCAAAGAAATAAT
JMSF043D15- TTCTACGAGCGTAAAAAATATGGTTTCAAGAAAAGATGATTGCTGCTCCAAAGAAATAAT
rJMSF043D15+ TTCTACGAGCGTAAAAAATATGGTTTCAAGAAAAGATGATTGCTGCTCCAAAGAAATAAT
                      ____________________________________________________________
consensus TTCTACGAGCGTAAAAAATATGGTTTCAAGAAAAGATGATTGCTGCTCCAAAGAAATAAT
 
. : . : . : . : . : . :
JMFF029N10- GCCAAATTGCAATTTCATTCAGTGTTTACCATTCTCTTGTCATGTAGTTTGTACTCTTAA
rJMFF038K05+ GCCAAATTGCAATTTCATTCAGTGTTTACCATTCTCTTGTCATGTAGTTTGTACTCTTAA
rJMFF029N10+ GCCAAATTGCAATTTCATTCAGTGTTTACCATTCTCTTGTCATGTAGTTTGTACTCTTAA
JMSF043D15- GCCAAATTGCAATTTCATTCAGTGTTTACCATTCTCTTGTCATGTAGTTTGTACTCTTAA
rJMSF043D15+ GCCAAATTGCAATTTCATTCAGTGTTTACCATTCTCTTGTCATGTAGTTTGTACTCTTAA
                      ____________________________________________________________
consensus GCCAAATTGCAATTTCATTCAGTGTTTACCATTCTCTTGTCATGTAGTTTGTACTCTTAA
 
. : . : . : . : . : . :
JMFF029N10- TTTTAA
rJMFF038K05+ TTTTAATGTGGTAGACATCCAAGAAAGAAAGTTAGTGATGTGTTTAGCCAACCTTTGGTT
rJMFF029N10+ TTTTAATGTGGTAGACATCCAAGAAAGAAAGTTAGTGATGTGTTTAGCCAACCTTTGGTT
JMSF043D15- TTTTAATGTGGTAGACATCCAAGAAAGAAAGTTAGTGATGTGTTTAGCCAACCTTTGGTT
rJMSF043D15+ TTTTAATGTGGTAGACATCCAAGAAAGAAAGTTAGTGATGTGTTTAGCCAACCTTTGGTT
                      ____________________________________________________________
consensus TTTTAATGTGGTAGACATCCAAGAAAGAAAGTTAGTGATGTGTTTAGCCAACCTTTGGTT
 
. : . : . : . : . : . :
rJMFF038K05+ TACTATGATCTTTTTTTCTGTCAGTACCGAGTGGGTGTCCTATCGTGGTTTTGCAACACG
rJMFF029N10+ TACTATGATCTTTTTTTCTGTCAGTACCGAGTGGGTGTCCTATCGTGGTTTTGCAACACG
JMSF043D15- TACTATGATCTTTTTTTCTGTCAGTACCGAGTGGGTGTCCTATCGTGGTTTTGCAACACG
rJMSF043D15+ TACTATGATCTTTTTTTCTGTCAGTACCGAGTGGGTGTCCTATCGTGGTTTTGCAACACG
                      ____________________________________________________________
consensus TACTATGATCTTTTTTTCTGTCAGTACCGAGTGGGTGTCCTATCGTGGTTTTGCAACACG
 
. : . : . : . : . : . :
rJMFF038K05+ AACTAGAAACACTGGCCTGAATTGTCTTGTTGG-TGTAATTCTTAAACAATT
rJMFF029N10+ AACTAGAAACACTGGCCTGAATTGTCTTGTTGGTTGTAATTCTTAAACAATT
JMSF043D15- AACTAGAAACACTGGCCTGAATTGTCTTGTTGGTTGTAATTCTTAAACAATT
rJMSF043D15+ AACTAGAAACACTGGCCTGAATTGTCTTGTTGGTTGTAATTCTTAAACAATTTGTAGGTA
                      ____________________________________________________________
consensus AACTAGAAACACTGGCCTGAATTGTCTTGTTGGTTGTAATTCTTAAACAATTTGTAGGTA