Previous Contig 013464:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011G17Sequence423013464 (6)788022425gb:BT005509_16384497e-07Arabidopsis thaliana clone U50487 unknown protein (At1g50710) mRNA, complete cds
JMSF030N02Sequence649013464 (6)706013464 (6)
JMSF043D08Sequence738020175733013464 (6)
JMSF052E03Sequence692013464 (6)955013464 (6)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030N02- GGCTGCTCTGTGAAGCCAGCCTCACGCAGTACCCTCCAATC
JMSF052E03- GCTGCTCTGTGAAGCCAGCCTCACGCAGTACCCTCCAATC
                      ____________________________________________________________
consensus GGCTGCTCTGTGAAGCCAGCCTCACGCAGTACCCTCCAATC
 
. : . : . : . : . : . :
JMSF011G17- ACTCACCACTTGGAACA
JMSF030N02- TAAGGAGGGAGTAGCCTCCGCCTTCGCTAAGACTACTCCATCAACTCACCACTTGGAATG
JMSF052E03- TAAGGAGGGAGTAGCCTCCGCCTTCGCTAAGACTACTCCATCAACTCACCACTTGGAATG
                      ____________________________________________________________
consensus TAAGGAGGGAGTAGCCTCCGCCTTCGCTAAGACTACTCCATCAACTCACCACTTGGAATG
 
. : . : . : . : . : . :
JMSF011G17- GGCAGGCGAGTGGATAGCAACCCCAGCCCAGCCTTCAAGGCAAGCCCTA-CGTTCCACCA
JMSF030N02- GGCAGGCCAGTAGATAGCAACCTAAGCCCAGCCTTCAGAGCAAGCCCAATTCTTCCACCA
JMSF052E03- GGCAGGCCAGTAGATAGCAACCTAAGCCCAGCCTTCAGAGCAAGCCCAATTCTTCCACCA
                      ____________________________________________________________
consensus GGCAGGCCAGTAGATAGCAACCTAAGCCCAGCCTTCAGAGCAAGCCCAATTCTTCCACCA
 
. : . : . : . : . : . :
JMSF011G17- TCTTAATGCTCCCACTTGGGTTACAAGCTCGTGCTACCAAGCCCAGCAAGCCATTCTTCT
JMSF030N02- TCTTAATGCTCTCGCTTGAGTTACAAGCTCGCACTACCAAGCCCAGCAAGCAATTCTTCT
JMSF052E03- TCTTAATGCTCTCGCTTGAGTTACAAGCTCGCACTACCAAGCCCAGCAAGCAATTCTTCT
rJMSF052E03+ TCTTNATGCTCTCGCTTGAGTTACAAGCTCGCACTACCAAGCCCAGCAAGCAATTCTTCT
                      ____________________________________________________________
consensus TCTTAATGCTCTCGCTTGAGTTACAAGCTCGCACTACCAAGCCCAGCAAGCAATTCTTCT
 
. : . : . : . : . : . :
JMSF011G17- AGCTAGGGAGTTATTATGAGAAAATATTTCTCATCTGGTTTCAATGTGGGATATTGTGCA
JMSF030N02- AGCTAGGGACTTATTAAGAGAACATATTTCTCATATGGTTTCGATGTGGGAAGTTGTGCG
JMSF052E03- AGCTAGGGACTTATTAAGAGAACATATTTCTCATATGGTTTCGATGTGGGAAGTTGTGCG
rJMSF052E03+ AGCTAGGGACTTATTAAGAGAACATATTTCTCATATGGTTTCGATGTGGGAAGTTGTGCG
                      ____________________________________________________________
consensus AGCTAGGGACTTATTAAGAGAACATATTTCTCATATGGTTTCGATGTGGGAAGTTGTGCG
 
. : . : . : . : . : . :
JMSF011G17- AGGCCTTGTTTCGCTTTCATGGGGAAAAAGTGGAGCAGACAAATATGGTGTACTCACTCA
JMSF030N02- AGGGCTTGTTTGGCTTTCATGGCGTAAAAATGGAGCAGACAACTATTGTGT----ATTCA
JMSF052E03- AGGGCTTGTTTGGCTTTCATGGCGTAAAAATGGAGCAGACAACTATTGTGT----ATTCA
rJMSF052E03+ AGGGCTTGTTTGGCTTTCATGGCGTAAAAATGGAGCAGACAACTATTGTGT----ATTCA
                      ____________________________________________________________
consensus AGGGCTTGTTTGGCTTTCATGGCGTAAAAATGGAGCAGACAACTATTGTGT----ATTCA
 
. : . : . : . : . : . :
JMSF011G17- TGGTTTTTGACAGCTATTAGATTTG
JMSF030N02- TGGTTTTTGACAGCTATGAGATTTGCGTTGTATCATTGTGACGGAAGGAGATGAAGAAAC
JMSF052E03- TGGTTTTTGACAGCTATGAGATTTGCGTTGTATCATTGTGACGGAAGGAGATGAAGAAAC
rJMSF052E03+ TGGTTTTTGACAGCTATGAGATTTGCGTTGTATCATTGTGACGGAAGGAGATGAAGAAAC
                      ____________________________________________________________
consensus TGGTTTTTGACAGCTATGAGATTTGCGTTGTATCATTGTGACGGAAGGAGATGAAGAAAC
 
. : . : . : . : . : . :
JMSF030N02- AACGGGCGCATTATTTGTAAGCATTGCTACTATATATGTCAAATTTCACAGTTTTGATCA
JMSF052E03- AACGGGCGCATTATTTGTAAGCATTGCTACTATATATGTCAAATTTCACAGTTTTGATCA
rJMSF030N02+ ACGGGCGCA-TATTTGTAAGCATTGCTACTATATATGTCAAA-TTCACAG-TTTGATCA
rJMSF052E03+ AACGGGCGCATTATTTGTAAGCATTGCTACTATATATGTCAAATTTCACAGTTTTGATCA
rJMSF043D08+ GGGCGCATTATTTGTAAGCATTGCTACTATATATGTCAAA-TTCACAGTTTTGATCA
                      ____________________________________________________________
consensus AACGGGCGCATTATTTGTAAGCATTGCTACTATATATGTCAAATTTCACAGTTTTGATCA
 
. : . : . : . : . : . :
JMSF030N02- TATATTGCATTTAGGGGAATGAAATTAGGGGTGTGAATTGAGATTATGCATTTTTCTTTT
JMSF052E03- TATATTGCATTTAGGGGAATGAAATTAGGGGTGTGAATTGAGATTATGCATTTTTCTTTT
rJMSF030N02+ TATATTGCA-TTAGGGGAATGAAATTAGGGGTGTGAATTGAGATTATGCATTTTTCTTTT
rJMSF052E03+ TATATTGCATTTAGGGGAATGAAATTAGGGGTGTGAATTGAGATTATGCATTTTTCTTTT
rJMSF043D08+ TATATTGCATTTAGGGGAATGAAATTAGGGGTGTGAATTGAGATTATGCATTTTTC-TTT
                      ____________________________________________________________
consensus TATATTGCATTTAGGGGAATGAAATTAGGGGTGTGAATTGAGATTATGCATTTTTCTTTT
 
. : . : . : . : . : . :
JMSF030N02- CATGCTAATTTGATCGTTGTTATGGATTATGGATAAATAATGTAGGCAGTTTACAGTTTA
JMSF052E03- CATGCTAATTTGATCGTTGTTATGGATTATGGATAAATAATGTAGGCAGTTTACAGTTTA
rJMSF030N02+ CATGCTAATTTGATCGTTGTTATGGATTATGGATAAATAATGTAGGCAGTTTACAGTTTA
rJMSF052E03+ CATGCTAATTTGATCGTTGTTATGGATTATGGATAAATAATGTAGGCAGTTTACAGTTTA
rJMSF043D08+ CATGCTAATTTGATCGTTGTTATGGATTATGGATAAATAATGTAGGCAGTTTACAGTTTA
                      ____________________________________________________________
consensus CATGCTAATTTGATCGTTGTTATGGATTATGGATAAATAATGTAGGCAGTTTACAGTTTA
 
. : . : . : . : . : . :
JMSF030N02- CATAAAGGCAATTCCNATTGCATTGGTGGAAGATCGAGAATCTATCAGCAAGCTCTTACT
JMSF052E03- CATAAAGGCAATTCCAATTGCATTGGTGGAAGATCGAGAATCTATCAGCAAGCTCTTACT
rJMSF030N02+ CATAAAGGCAATTCCAATTGCATTGGTGGAAGATCGAGAATCTATCAGCAAGCTCTTACT
rJMSF052E03+ CATAAAGGCAATTCCAATTGCATTGGTGGAAGATCGAGAATCTATCAGCAAGCTCTTACT
rJMSF043D08+ CATAAAGGCAATTCCAATTGCATTGGTGGAAGATCGAGAATCTATCAGCAAGCTCTTACT
                      ____________________________________________________________
consensus CATAAAGGCAATTCCAATTGCATTGGTGGAAGATCGAGAATCTATCAGCAAGCTCTTACT
 
. : . : . : . : . : . :
JMSF030N02- CAGTGTATATTG
JMSF052E03- CAGTGTATATTGTGGTTAGAATGTCTCCTGGTGAACTGTGAAACATACCACTTTA
rJMSF030N02+ CAGTGTATATTGTGGTTAGAATGTCTCCTGGTGAACTGTG-AACATACCACTTTAATTTC
rJMSF052E03+ CAGTGTATATTGTGGTTAGAATGTCTCCTGGTGAACTGTG-AACATACCACTTTAATTTC
rJMSF043D08+ CAGTGTATATTGTGGTTAGAATGTCTCCTGGTGAACTGTG-AACATACCACTTTAATTTC
                      ____________________________________________________________
consensus CAGTGTATATTGTGGTTAGAATGTCTCCTGGTGAACTGTG-AACATACCACTTTAATTTC
 
. : . : . : . : . : . :
rJMSF030N02+ TTCTTCTGATCTTGTAGTTCCTTACTAAGTTTCTCAAAGTTGCACATTGCAATATGGTAA
rJMSF052E03+ TTCTTCTGATCTTGTAGTTCCTTACTAAGTTTCTCAAAGTTGCACATTGCAATATGGTAA
rJMSF043D08+ TTCTTCTGATCTTGTAGTTCCTTACTAAGTTTCTCAAAGTTGCACATTGCAATATGGTAA
                      ____________________________________________________________
consensus TTCTTCTGATCTTGTAGTTCCTTACTAAGTTTCTCAAAGTTGCACATTGCAATATGGTAA
 
. : . : . : . : . : . :
rJMSF030N02+ CTTCCTTCTTTGTTTGATAACTGATACGCAATCCTATGAATTTGTAGCATTTCAATTTTT
rJMSF052E03+ CTTCCTTCTTTGTTTGATAACTGATACGCAATCCTATGAATTTGTAGCATTTCAATTTTT
rJMSF043D08+ CTTCCTTCTTTGTTTGATAACTGATACGCAATCCTATGAATTTGTAGCATTTCAATTTTT
                      ____________________________________________________________
consensus CTTCCTTCTTTGTTTGATAACTGATACGCAATCCTATGAATTTGTAGCATTTCAATTTTT
 
. : . : . : . : . : . :
rJMSF030N02+ TTCTGTTTGGTGTGACAGTCAGTCTGTGTTTGGCATTGGTTTCTTGATCCATAGTTTTGC
rJMSF052E03+ TTCTGTTTGGTGTGACAGTCAGTCTGTGTTTGGCATTGGTTTCTTGATCCATAGTTTTGC
rJMSF043D08+ TTCTGTTTGGTGTGACAGTCAGTCTGTGTTTGGCATTGGTTTCTTGATCCATAGTTTTGC
                      ____________________________________________________________
consensus TTCTGTTTGGTGTGACAGTCAGTCTGTGTTTGGCATTGGTTTCTTGATCCATAGTTTTGC
 
. : . : . : . : . : . :
rJMSF030N02+ ATTATTATATTGTTATTATGATGTTTTGCATTGTTGAAGCTCGTGAAAGCTACCATGCCT
rJMSF052E03+ ATTATTATATTGTTATTATGATGTTTTGCATTGTTGAAGCTCGTGAAAGCTACCATGCCT
rJMSF043D08+ ATTATTATATTGTTATTATGATGTTTTGCATTGTTGAAGCTCGTGAAAGCTACCATGCCT
                      ____________________________________________________________
consensus ATTATTATATTGTTATTATGATGTTTTGCATTGTTGAAGCTCGTGAAAGCTACCATGCCT
 
. : . : . : . : . : . :
rJMSF030N02+ TGTATTTAGTCTCTAACACTTCTAAGATCATATCGATGAAGCAGTGTATGGGTATTTGAA
rJMSF052E03+ TGTATTTAGTCTCTAACACTTCTAAGATCATATCGATGAAGCAGTGTATGGGTATTTGAA
rJMSF043D08+ TGTATTTAGTCTCTAACACTTCTAAGATCATATCGATGAAGCAGTGTATGGGTATTTGAA
                      ____________________________________________________________
consensus TGTATTTAGTCTCTAACACTTCTAAGATCATATCGATGAAGCAGTGTATGGGTATTTGAA
 
. : . : . : . : . : . :
rJMSF030N02+ TTGAAGGAGGAAACCTCTGCTTGCTGTTGTGGATACTCAAGGAAAGATACCTCTGATAGT
rJMSF052E03+ TTGAAGGAGGAAACCTCTGCTTGCTGTTGTGGATACTCAAGGAAAGATACCTCTGATAGT
rJMSF043D08+ TTGAAGGAGGAAACCTCTGCTTGCTGTTGTGGATACTCAAGGAAAGATACCTCTGATAGT
                      ____________________________________________________________
consensus TTGAAGGAGGAAACCTCTGCTTGCTGTTGTGGATACTCAAGGAAAGATACCTCTGATAGT
 
. : . : . : . : . : . :
rJMSF030N02+ ATGGTAGAAAATGCAATAATCTTGCAGATGCTTAATTGAATATTATTGAATG
rJMSF052E03+ ATGGTAGAAAATGCAATAATCTTGCAGATGCTTAATTGAATATTATTGAATGTTGTAATG
rJMSF043D08+ ATGGTAGAAAATGCAATAATCTTGCAGATGCTTAATTGAATATTATTGAATGTTGTAATG
                      ____________________________________________________________
consensus ATGGTAGAAAATGCAATAATCTTGCAGATGCTTAATTGAATATTATTGAATGTTGTAATG