Previous Contig 013457:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014J03Sequence557013457 (5)gb:AF479279_18035153e-55Arabidopsis thaliana SEC6 (SEC6) mRNA, complete cds.763013457 (5)gb:AF479279_18035153e-81Arabidopsis thaliana SEC6 (SEC6) mRNA, complete cds.
JMSF043A16Sequence785007624 (3)gb:AY046014_15615062e-81Arabidopsis thaliana unknown protein (At1g71820) mRNA, complete cds.>gb:AY133819638013457 (5)gb:AF479279_18035157e-51Arabidopsis thaliana SEC6 (SEC6) mRNA, complete cds.
JMSF044L05Sequence659007624 (3)gb:AY046014_15615065e-62Arabidopsis thaliana unknown protein (At1g71820) mRNA, complete cds.>gb:AY133819805013457 (5)gb:AY046014_1561506e-132Arabidopsis thaliana unknown protein (At1g71820) mRNA, complete cds.>gb:AY133819
JMSF053O13Sequence629007624 (3)gb:AY046014_15615065e-61Arabidopsis thaliana unknown protein (At1g71820) mRNA, complete cds.>gb:AY133819842013457 (5)gb:AF479279_18035151e-96Arabidopsis thaliana SEC6 (SEC6) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044L05+ CTGAGA
                      ____________________________________________________________
consensus CTGAGA
 
. : . : . : . : . : . :
rJMSF044L05+ GGTTTATTCAGTGGCTGAGAAAGCTAAGTGACCAAGCTAATAATCTGACAAATATAGAGA
                      ____________________________________________________________
consensus GGTTTATTCAGTGGCTGAGAAAGCTAAGTGACCAAGCTAATAATCTGACAAATATAGAGA
 
. : . : . : . : . : . :
rJMSF044L05+ TTTTAAAGGTAACTGGCTGGGTAGTGGAATACCAAGAGAATTTAATTGCACTTGGAGTTG
                      ____________________________________________________________
consensus TTTTAAAGGTAACTGGCTGGGTAGTGGAATACCAAGAGAATTTAATTGCACTTGGAGTTG
 
. : . : . : . : . : . :
rJMSF044L05+ ATGAGTCTTTGGCTCAAGTTTGTTCTGAGAGTGGTTCAATGGATCCCCTCATGAATGCTT
                      ____________________________________________________________
consensus ATGAGTCTTTGGCTCAAGTTTGTTCTGAGAGTGGTTCAATGGATCCCCTCATGAATGCTT
 
. : . : . : . : . : . :
rJMSF044L05+ ATGTTGAGAGAATGCAGGCAACAACTAAGAAATGGTACCTGAACATTCTTGAGGCAGATA
                      ____________________________________________________________
consensus ATGTTGAGAGAATGCAGGCAACAACTAAGAAATGGTACCTGAACATTCTTGAGGCAGATA
 
. : . : . : . : . : . :
rJMSF044L05+ AAGTACAGCCACCAAAAAAGACTGATGATGGAAAACTATATACACCTGCTGCTGTTGACC
                      ____________________________________________________________
consensus AAGTACAGCCACCAAAAAAGACTGATGATGGAAAACTATATACACCTGCTGCTGTTGACC
 
. : . : . : . : . : . :
rJMSF044L05+ TGTTTAGGATCCTTGAGAGCAAGTGCAAATTGTGCGAGACAATAGTACTGATGTCATGCT
                      ____________________________________________________________
consensus TGTTTAGGATCCTTGAGAGCAAGTGCAAATTGTGCGAGACAATAGTACTGATGTCATGCT
 
. : . : . : . : . : . :
rJMSF044L05+ ATACAGAATTGCTTTGGCAATAATTCAGGTAATGATTGACTTTCAAGGTGCTGAAAGAAA
                      ____________________________________________________________
consensus ATACAGAATTGCTTTGGCAATAATTCAGGTAATGATTGACTTTCAAGGTGCTGAAAGAAA
 
. : . : . : . : . : . :
rJMSF044L05+ GAGATTAGAAGAACCTGCATCTGAAATTGGTTTGGAGCCTCTATGTGCAGTGATAAACAA
JMFF014J03- AAGATCCTGCATCTGAAATTGGTTTGGAGCCTCTATGTGCAGTGATAAACAA
                      ____________________________________________________________
consensus GAGATTAGAAGATCCTGCATCTGAAATTGGTTTGGAGCCTCTATGTGCAGTGATAAACAA
 
. : . : . : . : . : . :
rJMSF044L05+ TAACCTTCGCTGTTATGATCTCGCTATGGAGCTAAGTTCTAGCACCATTGAAGCTCTTCC
JMFF014J03- TAACCTTCGCTGTTATGATCTCGCTATGGAGCTAAGTTCTAGCACCATTGAAGCTCTTCC
                      ____________________________________________________________
consensus TAACCTTCGCTGTTATGATCTCGCTATGGAGCTAAGTTCTAGCACCATTGAAGCTCTTCC
 
. : . : . : . : . : . :
rJMSF044L05+ GGAGAATTATGCTGAGCAGGTTAATTTTGAGGATACCTGCAAAGGTTTTCTTGAGGTTGC
JMFF014J03- -GACAATTATGCTGAGCAGGTTAATTTTGAGGATACCTGCAAAGGTTTTCTTGAGGTTGC
rJMSF053O13+ TGCTGAGCAGGTTAATTTTGAGGATACCTGCAAAGGTTTTCTTGAGGTTGC
                      ____________________________________________________________
consensus GGAGAATTATGCTGAGCAGGTTAATTTTGAGGATACCTGCAAAGGTTTTCTTGAGGTTGC
 
. : . : . : . : . : . :
rJMSF044L05+ CAAGGAAGCTGTTCATCAAACTGTCAATGTCA-TTTTTGAAGATCCTGGAGTGCAGGAAT
JMFF014J03- CAAGGAAGCTGTTCATCAAACTGTCAATGTCA-TTTTTGAAGATCCTGGAGTGCAGGAAT
rJMSF053O13+ CAAGGAAGCTGTTCATCAAACTGTCAATGTCATTTTTTGAAGATCCTGGAGTGCAGGAAT
                      ____________________________________________________________
consensus CAAGGAAGCTGTTCATCAAACTGTCAATGTCA-TTTTTGAAGATCCTGGAGTGCAGGAAT
 
. : . : . : . : . : . :
rJMSF044L05+ TATTTGTTAAACTGTATCAAAGAGATTGGTTGGAAGGACAGGTTACTGAGTACCTAGTTG
JMFF014J03- TATTTGTTAAACTGTATCAAAGAGATTGGTTGGAAGGACAGGTTACTGAGTACCTAGTTG
rJMSF053O13+ TATTTGTTAAACTGTATCAAAGAGATTGGTTGGAAGGACAGGTTACTGAGTACCTAGTTG
rJMFF014J03+ AGTTG
                      ____________________________________________________________
consensus TATTTGTTAAACTGTATCAAAGAGATTGGTTGGAAGGACAGGTTACTGAGTACCTAGTTG
 
. : . : . : . : . : . :
rJMSF044L05+ CAACATTTGTGGATTATTTCACTGATGTGAAAATGTACATTGAGGAAAGATCATTTAGGC
JMFF014J03- CAACATTTGTGGATTATTTCACTGATGTGAAAATGTACATTGAGGAAAGATCATTTAGGC
rJMSF053O13+ CAACATTTGTGGATTATTTCACTGATGTGAAAATGTACATTGAGGAAAGATCATTTAGGC
rJMFF014J03+ CAACATTTGTGGATTATTTCACTGATGTGAAAATGTACATTGAGGAAAGATCATTTAGGC
                      ____________________________________________________________
consensus CAACATTTGTGGATTATTTCACTGATGTGAAAATGTACATTGAGGAAAGATCATTTAGGC
 
. : . : . : . : . : . :
rJMSF044L05+ GTTTTGTTGAGGCTTGCT
JMFF014J03- GTTTTGTTGAGGCTTGCTTGGAGGAGACAGTAGTTGTTTATGTGGATCATCTGCTTATAC
rJMSF053O13+ GTTTTGTTGAGGCTTGCTTGGAGGAGACAGTAGTTGTTTATGTGGATCATCTGCTTATAC
rJMFF014J03+ GTTTTGTTGAGGCTTGCTTGGAGGAGACAGTAGTTGTTTATGTGGATCATCTGCTTATAC
                      ____________________________________________________________
consensus GTTTTGTTGAGGCTTGCTTGGAGGAGACAGTAGTTGTTTATGTGGATCATCTGCTTATAC
 
. : . : . : . : . : . :
JMFF014J03- AGAAAAATTATATCAAGGAAGAAACAATTGAAAGAATGAGGCTAAGATGAAGAAGTTCTC
rJMSF053O13+ AGAAAAATTATATCAAGGAAGAAACAATTGAAAGAATGAGGCT-AGATGAAGAAGTTCTC
rJMFF014J03+ AGAAAAATTATATCAAGGAAGAAACAATTGAAAGAATGAGGCT-AGATGAAGAAGTTCTC
rJMSF043A16+ AAGAAACANTTGAAAGAATGAGGCT-AGATGAAGAAGTTCTC
                      ____________________________________________________________
consensus AGAAAAATTATATCAAGGAAGAAACAATTGAAAGAATGAGGCT-AGATGAAGAAGTTCTC
 
. : . : . : . : . : . :
JMFF014J03- ATGGATTTCTTCAGGGAGTACATCAGTGTTTCTAAAGTAGAGAACAGATTAAGGATACTT
rJMSF053O13+ ATGGATTTCTTCAGGGAGTACATCAGTGTTTCTAAAGTAGAGAACAGATTAAGGATACTT
rJMFF014J03+ ATGGATTTCTTCAGGGAGTACATCAGTGTTTCTAAAGTAGAGAACAGATTAAGGATACTT
rJMSF043A16+ ATGGATTTCTTCAGGGAGTACATCAGTGTTTCTAAAGTAGAGAACAGATTAAGGATACTT
                      ____________________________________________________________
consensus ATGGATTTCTTCAGGGAGTACATCAGTGTTTCTAAAGTAGAGAACAGATTAAGGATACTT
 
. : . : . : . : . : . :
JMFF014J03- GGTGATTTAAGAGAACTTGCTTCTTCA
rJMSF053O13+ GGTGATTTAAGAGAACTTGCTTCTTCAGAGAGCCCTGATTCTTTCACCCTCGTCTACACA
rJMFF014J03+ GGTGATTTAAGAGAACTTGCTTCTTCAGAGAGCCCTGATTCTTTCACCCTCGTCTACACA
rJMSF043A16+ GGTGATTTAAGAGAACTTGCTTCTTCAGAGAGCCCTGATTCTTTCACCCTCGTCTACACA
                      ____________________________________________________________
consensus GGTGATTTAAGAGAACTTGCTTCTTCAGAGAGCCCTGATTCTTTCACCCTCGTCTACACA
 
. : . : . : . : . : . :
rJMSF053O13+ AACATTCTGGAGCATCAACCAGATTGTCCTCCAGAGGTAGTTGAAAAGATTGTGGGATTG
rJMFF014J03+ AACATTCTGGAGCATCAACCAGATTGTCCTCCAGAGGTAGTTGAAAAGATTGTGGGATTG
rJMSF043A16+ AACATTCTGGAGCATCAACCAGATTGTCCTCCAGAGGTAGTTGAAAAGATTGTGGGATTG
                      ____________________________________________________________
consensus AACATTCTGGAGCATCAACCAGATTGTCCTCCAGAGGTAGTTGAAAAGATTGTGGGATTG
 
. : . : . : . : . : . :
rJMSF053O13+ CGAGAGGGCATACCNCGAAAAGATGCCAGAGAGGTTGTTCAAGAATGCAAAGAAATATAT
rJMFF014J03+ CGAGAGGGCATACCACGAAAAGATGCCAGAGAGGTTGTTCAAGAATGCAAAGAAATATAT
rJMSF043A16+ CGAGAGGGCATACCACGAAAAGATGCCAGAGAGGTTGTTCAAGAATGCAAAGAAATATAT
                      ____________________________________________________________
consensus CGAGAGGGCATACCACGAAAAGATGCCAGAGAGGTTGTTCAAGAATGCAAAGAAATATAT
 
. : . : . : . : . : . :
rJMSF053O13+ GAAAACTCTCTGATTGATGGGAATCCTCCAAAGGCGGGCTTTGTTTTCCCCAGGGTGAAG
rJMFF014J03+ GAAAACTCTCTGATTGATGGGAATCCTCCAAAGGCGGGCTTTGTTTTCCCCAGGGTGAAG
rJMSF043A16+ GAAAACTCTCTGATTGATGGGAATCCTCCAAAGGCGGGCTTTGTTTTCCCCAGGGTGAAG
                      ____________________________________________________________
consensus GAAAACTCTCTGATTGATGGGAATCCTCCAAAGGCGGGCTTTGTTTTCCCCAGGGTGAAG
 
. : . : . : . : . : . :
rJMSF053O13+ AGCTTGTCACATTCAAAAGTTTCAAACTTGTGGAGAAAGCTTACGTAAGCTGGATCATTG
rJMFF014J03+ AGCTTGTCACATTCAAAAGTTTCAAACTTGTGGAGAAAGCTTACGTAAGCTGGATCATTG
rJMSF043A16+ AGCTTGTCACATTC--AAGTTTCAAACTTGTGGAGAAAGCTTACGTAAGCTGGATCATTG
                      ____________________________________________________________
consensus AGCTTGTCACATTCAAAAGTTTCAAACTTGTGGAGAAAGCTTACGTAAGCTGGATCATTG
 
. : . : . : . : . : . :
rJMSF053O13+ AAATTATCAGGTTCTATATACTCCCCNTTATTCTGAATGTTACTATGATACGTTGCTGCT
rJMFF014J03+ AAATTATCAGGTTCTATATACTCCCCATTATTCTGAATGTTACTATGATACGTTGCTGCT
rJMSF043A16+ AAATTATCAGGTTCTATATACTCCCCATTATTCTGAATGTTACTATGATACGTTGCTGCT
                      ____________________________________________________________
consensus AAATTATCAGGTTCTATATACTCCCCATTATTCTGAATGTTACTATGATACGTTGCTGCT
 
. : . : . : . : . : . :
rJMSF053O13+ GTGTAATATTCTTATTTCCTACTGCTGGTTACTGTTATTTTTTGTAAAAAAAAAATGTAT
rJMFF014J03+ GTGTAATATTCTTATTTCCTACTGCTGGTTACTGTTATTTTTTGT-AAAAAAAAATGTAT
rJMSF043A16+ GTGTAATATTCTTATTTCCTACTGCTGGTTACTGTTATTTTTTGT-AAAAAAAAATGTAT
                      ____________________________________________________________
consensus GTGTAATATTCTTATTTCCTACTGCTGGTTACTGTTATTTTTTGT-AAAAAAAAATGTAT
 
. : . : . : . : . : . :
rJMSF053O13+ TTGTGGTGTGTC
rJMFF014J03+ TTGTGGTGTGTCTAACTCCATTTCTTATCAGAAGAAAATATTGATGTGATTGTATATTTT
rJMSF043A16+ TTGTGGTGTGTCTAACTCCATTTCTTATCAGAAGAAAATATTGATGTGATTGTATATTTT
                      ____________________________________________________________
consensus TTGTGGTGTGTCTAACTCCATTTCTTATCAGAAGAAAATATTGATGTGATTGTATATTTT
 
. : . : . : . : . : . :
rJMFF014J03+ TCTTTCCATGCCCTAAGAAAACGTTCTTTTAT
rJMSF043A16+ TCTTTCCATGCCCTAAGAAAACGTTCTTTTATTGAGAGAATTATGAGCTTCATTCCAGGG
                      ____________________________________________________________
consensus TCTTTCCATGCCCTAAGAAAACGTTCTTTTATTGAGAGAATTATGAGCTTCATTCCAGGG