Previous Contig 013444:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS059C07Sequence626013444 (2)pir|T04446|T044463e-81hypothetical protein F4D11.10 - Arabidopsis thaliana>gb:ATCHRIV78_1547199 Arabid
JMSF042N17Sequence634003510 (3)693013444 (2)gb:AK118321_18163053e-73Arabidopsis thaliana At4g32790 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS059C07- GAG
                      ____________________________________________________________
consensus GAG
 
. : . : . : . : . : . :
JMFS059C07- AACTAGTTGTGAAAGATCCTCGAAAGGCTCACTTGTTTTACATGCCTTTTAGTTCACGGA
                      ____________________________________________________________
consensus AACTAGTTGTGAAAGATCCTCGAAAGGCTCACTTGTTTTACATGCCTTTTAGTTCACGGA
 
. : . : . : . : . : . :
JMFS059C07- TGCTGGAGTATACTTTGTATGTACGTAACTCCCACGATCGGACCAATCTCCGACAGTATC
                      ____________________________________________________________
consensus TGCTGGAGTATACTTTGTATGTACGTAACTCCCACGATCGGACCAATCTCCGACAGTATC
 
. : . : . : . : . : . :
JMFS059C07- TGAAGGATTACTCGGAAAGGATTGCTGCTAAATACCGCTTCTGGAACAGAACTGGCGGGG
                      ____________________________________________________________
consensus TGAAGGATTACTCGGAAAGGATTGCTGCTAAATACCGCTTCTGGAACAGAACTGGCGGGG
 
. : . : . : . : . : . :
JMFS059C07- CTGATCATTTTCTCGTAGCATGCCATGACTGGGCTCCTTACGAAACGCGACACCACATGG
                      ____________________________________________________________
consensus CTGATCATTTTCTCGTAGCATGCCATGACTGGGCTCCTTACGAAACGCGACACCACATGG
 
. : . : . : . : . : . :
JMFS059C07- AGCATTGCATCAAGGCTCTCTGCAATGCCGACGTTACTGCAGGGTTCAAAATAGGAAGGG
                      ____________________________________________________________
consensus AGCATTGCATCAAGGCTCTCTGCAATGCCGACGTTACTGCAGGGTTCAAAATAGGAAGGG
 
. : . : . : . : . : . :
JMFS059C07- ATGTGTCCCTGCCCGAAACATACATTCGCTCCCAGCGGAATCCTCTGAGAGATCTCGGTG
rJMSF042N17+ GCTCCCAGCGGAATCCTTTGAGAGATCTCGGTG
                      ____________________________________________________________
consensus ATGTGTCCCTGCCCGAAACATACATTCGCTCCCAGCGGAATCCTTTGAGAGATCTCGGTG
 
. : . : . : . : . : . :
JMFS059C07- GGAAACCGGCATCGCAGAGGCGTATTCTCGCTTTCTACGCTGGAAACATGCACGGGTACT
rJMSF042N17+ GGAAACCGGCATCGCAGAGGCGTATTCTCGCTTTCTACGCTGGAAACATGCACGGGTACT
                      ____________________________________________________________
consensus GGAAACCGGCATCGCAGAGGCGTATTCTCGCTTTCTACGCTGGAAACATGCACGGGTACT
 
. : . : . : . : . : . :
JMFS059C07- TACGACCCATCCTGCTCGAGCATTGGAAGGACAGGGACCCCGATATGAAGATCTTCGGCC
rJMSF042N17+ TACGACCCATCCTGCTCGAGCATTGGAAGGACAGGGACCCCGATATGAAGATCTTCGGCC
                      ____________________________________________________________
consensus TACGACCCATCCTGCTCGAGCATTGGAAGGACAGGGACCCCGATATGAAGATCTTCGGCC
 
. : . : . : . : . : . :
JMFS059C07- CAATGCCACCCGGTGTTGCCAGCAAAATGAGCTACATTCAACACATGAAGAGCAGCAAGT
rJMSF042N17+ CAATGCCACCCGGTGTTGCCAGCAAAATGAGCTACATTCAACACATGAAGAGCAGCAAGT
                      ____________________________________________________________
consensus CAATGCCACCCGGTGTTGCCAGCAAAATGAGCTACATTCAACACATGAAGAGCAGCAAGT
 
. : . : . : . : . : . :
JMFS059C07- TCTGCATCTGCCCGAAGGGCTATGAAGTGAACAGCCCGAGGGTCGTCGAAGCCATCTACT
rJMSF042N17+ TCTGCATCTGCCCGAAGGGCTATGAAGTGAACAGCCCGAGGGTCGTCGAAGCCATCTACT
                      ____________________________________________________________
consensus TCTGCATCTGCCCGAAGGGCTATGAAGTGAACAGCCCGAGGGTCGTCGAAGCCATCTACT
 
. : . : . : . : . : . :
JMFS059C07- ACGAATGCGTGCCAGTCATCGTA
rJMSF042N17+ ACGAATGCGTGCCAGTCATCGTATCCGACAACTTTGTGCCGCCGTTTTTTGATGTCCTGA
                      ____________________________________________________________
consensus ACGAATGCGTGCCAGTCATCGTATCCGACAACTTTGTGCCGCCGTTTTTTGATGTCCTGA
 
. : . : . : . : . : . :
rJMSF042N17+ ACTGGGATGCATTCTCCATAGTTGTTGCAGAGAAGGACATACCGAACCTGAAAGATATAC
                      ____________________________________________________________
consensus ACTGGGATGCATTCTCCATAGTTGTTGCAGAGAAGGACATACCGAACCTGAAAGATATAC
 
. : . : . : . : . : . :
rJMSF042N17+ TCCTCTCTGTACCAGAAGAGAAGTATCTCCAGATGCAAGTTGCTGTGAGAAAGGTTCAGC
                      ____________________________________________________________
consensus TCCTCTCTGTACCAGAAGAGAAGTATCTCCAGATGCAAGTTGCTGTGAGAAAGGTTCAGC
 
. : . : . : . : . : . :
rJMSF042N17+ AGCATTTTCTTTGGCATGTGAAGCCTCAAAAATATGATCTTTTCCACATGACCCTTCATT
                      ____________________________________________________________
consensus AGCATTTTCTTTGGCATGTGAAGCCTCAAAAATATGATCTTTTCCACATGACCCTTCATT
 
. : . : . : . : . : . :
rJMSF042N17+ CAATTTGGTACAATAGAGTCTTCCAAGTAAAAGCAAGGTGATGAAGAAGAAAATGGCACC
                      ____________________________________________________________
consensus CAATTTGGTACAATAGAGTCTTCCAAGTAAAAGCAAGGTGATGAAGAAGAAAATGGCACC
 
. : . : . : . : . : . :
rJMSF042N17+ AATACCATTAACTGCCAGGAAGCTTTATATGGAAAAACATCTCTTTTCTGCAATCTGCAG
                      ____________________________________________________________
consensus AATACCATTAACTGCCAGGAAGCTTTATATGGAAAAACATCTCTTTTCTGCAATCTGCAG
 
. : . : . : . : . : . :
rJMSF042N17+ TGTGTTGTTTGCTTAATGTAAATTTTTTTTGCAGGTTTATGCTGTAAATTACTATTGACC
                      ____________________________________________________________
consensus TGTGTTGTTTGCTTAATGTAAATTTTTTTTGCAGGTTTATGCTGTAAATTACTATTGACC