Previous Contig 013441:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF042M19Sequence282006053 (8)gb:AP002969_18239969e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045669013441 (2)
JMSF043M19Sequence280006053 (8)gb:AP001297_18209422e-24Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:F14O13.507013441 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042M19+ TGGAGGAAAAG
                      ____________________________________________________________
consensus TGGAGGAAAAG
 
. : . : . : . : . : . :
rJMSF042M19+ ATGAACTCACAAGGCATGNCAATGAGAAGCCTGGAAAGTTAGATGACATCTGGAAGAAAA
                      ____________________________________________________________
consensus ATGAACTCACAAGGCATGNCAATGAGAAGCCTGGAAAGTTAGATGACATCTGGAAGAAAA
 
. : . : . : . : . : . :
rJMSF043M19+ TCTAANGATGATAATCTTCATCATGGGGATCATAA
rJMSF042M19+ TCTGCATAATTCTGATTCAATGAACTCTAATGATGATAATCTTCATCATGGGGATCATAA
                      ____________________________________________________________
consensus TCTGCATAATTCTGATTCAATGAACTCTAATGATGATAATCTTCATCATGGGGATCATAA
 
. : . : . : . : . : . :
rJMSF043M19+ AAAAAGTGTGAAACCAGAGGGCAGTGACAGTGAAGGATCTGAGTTCACCAATAGGGAACA
rJMSF042M19+ AAAAAGTGTGAAACCAGAGGGCAGTGACAGTGAAGGATCTGAGTTCACCAATAGGGAACA
                      ____________________________________________________________
consensus AAAAAGTGTGAAACCAGAGGGCAGTGACAGTGAAGGATCTGAGTTCACCAATAGGGAACA
 
. : . : . : . : . : . :
rJMSF043M19+ ATGTCATTCTTAAATACTGTAATTTGAATATAGAGATACCGGTGATTAGAGGAGTTTNTT
rJMSF042M19+ ATGTCATTCTTAAATACTGTAATTTGAATATAGAGATACCGGTGATTAGAGGAGTTTCTT
                      ____________________________________________________________
consensus ATGTCATTCTTAAATACTGTAATTTGAATATAGAGATACCGGTGATTAGAGGAGTTTCTT
 
. : . : . : . : . : . :
rJMSF043M19+ CCATTGGAGTATTGGACNNTGATTCAAAGCTTTCTGATTCCACTTGTGTGAGGGCCAATT
rJMSF042M19+ CCATTGGAGTATTGGACACTGATTCAAAGCTTTCTGATTCCATTTGTGTGAGGGCCAATT
                      ____________________________________________________________
consensus CCATTGGAGTATTGGACACTGATTCAAAGCTTTCTGATTCCATTTGTGTGAGGGCCAATT
 
. : . : . : . : . : . :
rJMSF043M19+ TTGTGAACAATGTGACAGCAGATTGTGTTGAAGCTTAGGTTTTGAGGAACCAGATCCTAA
rJMSF042M19+ TTGTGAACAATGTGACAGCAGATTGTGTTGAAGCTTAGGTTTTGAGGAACCAGATCCTAA
                      ____________________________________________________________
consensus TTGTGAACAATGTGACAGCAGATTGTGTTGAAGCTTAGGTTTTGAGGAACCAGATCCTAA
 
. : . : . : . : . : . :
rJMSF043M19+ TTTGTACAAGAGAGGGCTCCCATAGGAGATGTAGTGGTCACTTNTGANTACTCGCTGTTC
rJMSF042M19+ TTTGTACAAGAGAGGGCTCCCATAGGAGATGTAGTGGTCACTTTTGATTACTCGCTGTTC
                      ____________________________________________________________
consensus TTTGTACAAGAGAGGGCTCCCATAGGAGATGTAGTGGTCACTTTTGATTACTCGCTGTTC
 
. : . : . : . : . : . :
rJMSF043M19+ GTGNGNCACTTTCGCTGTGTTTGCTTTGNATTGCAGGTGGTGGAGGCAATTGGAACCNGA
rJMSF042M19+ GTGTGACACTTTCGCTGTGTTTGCTTTGTATTGCAGGTGGTGGAGGCAATTGGAACCTGA
                      ____________________________________________________________
consensus GTGTGACACTTTCGCTGTGTTTGCTTTGTATTGCAGGTGGTGGAGGCAATTGGAACCTGA
 
. : . : . : . : . : . :
rJMSF043M19+ TGAAGCAATGATTGNNGGTATTATATTCAACAATTGTCTTTGAACCCTTGTGGATCAACT
rJMSF042M19+ TGAAGCAATGATTGTTGGTATTATATTCAACAATTGTCTTTGAACCCTTGTGGATCAACT
                      ____________________________________________________________
consensus TGAAGCAATGATTGTTGGTATTATATTCAACAATTGTCTTTGAACCCTTGTGGATCAACT
 
. : . : . : . : . : . :
rJMSF043M19+ GTNCAATGTTTTTTTACGCAAACTACTTTANGANGTTTGCTGNATGGTGGAC
rJMSF042M19+ GTGCAATGTTTTTTTA-GCAAACTACTTTATGA-GTTTGCTGTATGGTGGACTATTACCT
                      ____________________________________________________________
consensus GTGCAATGTTTTTTTACGCAAACTACTTTATGANGTTTGCTGTATGGTGGACTATTACCT
 
. : . : . : . : . : . :
rJMSF042M19+ CTGTCAAGAGGTAGTGAATTTCTTAATTGTATGCCCATGTAAGGATTCTGACTGCTATCT
                      ____________________________________________________________
consensus CTGTCAAGAGGTAGTGAATTTCTTAATTGTATGCCCATGTAAGGATTCTGACTGCTATCT