Previous Contig 013437:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019N21Sequence543001481 (4)723013437 (3)gb:AP002953_18239724e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P042
JMFS033F03Sequence618013437 (3)gb:BT008322_16395396e-96Arabidopsis thaliana At1g56720 gene, complete cds.
JMSF042L23Sequence724001481 (4)gb:AP002953_18239725e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P042701013437 (3)gb:AP002953_18239722e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P042

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS033F03- TCCTCAACAACCTAGGCCAGGCAGAGAAAGAATTTAGATAG
                      ____________________________________________________________
consensus TCCTCAACAACCTAGGCCAGGCAGAGAAAGAATTTAGATAG
 
. : . : . : . : . : . :
JMFS033F03- CTACTTCAGCCCCATTGATCAATTGGGCTGAAGTAGCTATCAAGAAGCTCCTCAACAACC
                      ____________________________________________________________
consensus CTACTTCAGCCCCATTGATCAATTGGGCTGAAGTAGCTATCAAGAAGCTCCTCAACAACC
 
. : . : . : . : . : . :
JMFS033F03- TAGGCCAGGCAGAGAAAGAATTTAGAGTGGAAGTCGAAGCCATTGGCCATGTGCGACATA
                      ____________________________________________________________
consensus TAGGCCAGGCAGAGAAAGAATTTAGAGTGGAAGTCGAAGCCATTGGCCATGTGCGACATA
 
. : . : . : . : . : . :
JMFS033F03- AACACTTAGTTCGCCTTTTGGGATACTGCATTGAAGGAACTCATAGGATTCTGGTCTATG
                      ____________________________________________________________
consensus AACACTTAGTTCGCCTTTTGGGATACTGCATTGAAGGAACTCATAGGATTCTGGTCTATG
 
. : . : . : . : . : . :
JMFS033F03- AGTATGTAAACAATGGAAACTTAGAGCAATGGCTTCATGGAGCTATGCAGCAACACGGAT
                      ____________________________________________________________
consensus AGTATGTAAACAATGGAAACTTAGAGCAATGGCTTCATGGAGCTATGCAGCAACACGGAT
 
. : . : . : . : . : . :
JMFS033F03- ATCTTACATGGGAAGCGAGGATGAAGGTTCTCCTTGGCACAGCTAAGGCTCTTGCGTACT
                      ____________________________________________________________
consensus ATCTTACATGGGAAGCGAGGATGAAGGTTCTCCTTGGCACAGCTAAGGCTCTTGCGTACT
 
. : . : . : . : . : . :
JMFS033F03- TGCACGAGAACATCGAGCCAAAGGTGGTTCATCGGGACATCAAATCAAGCAATATTCTAA
                      ____________________________________________________________
consensus TGCACGAGAACATCGAGCCAAAGGTGGTTCATCGGGACATCAAATCAAGCAATATTCTAA
 
. : . : . : . : . : . :
JMFS033F03- TAGACGACGAGTTCAACGCTAAGGTCTCGGACTTTGGTCTTGCTAAGCTGCTGGGTGCTG
                      ____________________________________________________________
consensus TAGACGACGAGTTCAACGCTAAGGTCTCGGACTTTGGTCTTGCTAAGCTGCTGGGTGCTG
 
. : . : . : . : . : . :
JMFS033F03- GGAAAAGCCACATCTCGACAAGAGTCATGGGTACTTTTGGATATGTGGCTCCTGAATATG
rJMFF019N21+ TCTCGACAAGAGTCATGGGTACTTTTGGATATGTGGCTCCTGAATATG
                      ____________________________________________________________
consensus GGAAAAGCCACATCTCGACAAGAGTCATGGGTACTTTTGGATATGTGGCTCCTGAATATG
 
. : . : . : . : . : . :
JMFS033F03- CAAATACGGGGCTCTTGAATGAAAAGAGTGACGTTTACAGCTTTGGAGTTGTTCTGTTAG
rJMFF019N21+ CAAATACGGGGCTCTTGAATGAAAAGAGTGACGTTTACAGCTTTGGAGTTGTTCTGTTAG
rJMSF042L23+ TGAAAAGAGTGACGTTTACAGCTTGGGAGTTGTTCTGTTAG
                      ____________________________________________________________
consensus CAAATACGGGGCTCTTGAATGAAAAGAGTGACGTTTACAGCTTTGGAGTTGTTCTGTTAG
 
. : . : . : . : . : . :
JMFS033F03- AAGCTATTACCGGAAGAGACCCAGTGGACTACGGCCG
rJMFF019N21+ AAGCTATTACCGGAAGAGACCCAGTGGACTACGGCCGTCCTGCTCAAGAGGTGAATCTCG
rJMSF042L23+ AAGCTATTACCGGAAGAGACCCAGTGGACTACGGCCGTCCTGCTCAAGAGGTGAATCTCG
                      ____________________________________________________________
consensus AAGCTATTACCGGAAGAGACCCAGTGGACTACGGCCGTCCTGCTCAAGAGGTGAATCTCG
 
. : . : . : . : . : . :
rJMFF019N21+ TTGATTGGCTGAAAATGATGGTTGGAAGCAGGCGCTCCGAGGAAGTTGTTGACCCAAATA
rJMSF042L23+ TTGATTGGCTGAAAATGATGGTTGGAAGCAGGCGCTCCGAGGAAGTTGTTGACCCAAATA
                      ____________________________________________________________
consensus TTGATTGGCTGAAAATGATGGTTGGAAGCAGGCGCTCCGAGGAAGTTGTTGACCCAAATA
 
. : . : . : . : . : . :
rJMFF019N21+ TCGGTTCAAGGCCATCAACAAGGGCTTTTAAGCGAGCCCTTTTGACTGCTTTGAGATGCG
rJMSF042L23+ TCGGTTCAAGGCCATCAACAAGGGCTTTTAAGCGAGCCCTTTTGACTGCTTTGAGATGCG
                      ____________________________________________________________
consensus TCGGTTCAAGGCCATCAACAAGGGCTTTTAAGCGAGCCCTTTTGACTGCTTTGAGATGCG
 
. : . : . : . : . : . :
rJMFF019N21+ TTGATCCAGATTCTGACAAGAGACCCAAGATGAGCCAAGTCGTTCGTATGCTTGAATCAG
rJMSF042L23+ TTGATCCAGATTCTGACAAGAGACCCAAGATGAGCCAAGTCGTTCGTATGCTTGAATCAG
                      ____________________________________________________________
consensus TTGATCCAGATTCTGACAAGAGACCCAAGATGAGCCAAGTCGTTCGTATGCTTGAATCAG
 
. : . : . : . : . : . :
rJMFF019N21+ AAGAATATCCTATACCAAGAGAGGACCGTAGGCAGCGAAAAATCCAGGCAGGTGCAGCCG
rJMSF042L23+ AAGAATATCCTATACCAAGAGAGGACCGTAGGCAGCGAAAAATCCAGGCAGGTGCAGCCG
                      ____________________________________________________________
consensus AAGAATATCCTATACCAAGAGAGGACCGTAGGCAGCGAAAAATCCAGGCAGGTGCAGCCG
 
. : . : . : . : . : . :
rJMFF019N21+ AGAGTGAACCCCAGCGAGAGAACTACGAGACTGACAAGAGCGACAACCCAGATTCAACAT
rJMSF042L23+ AGAGTGAACCCCAGCGAGAGAACTACGAGACTGACAAGAGCGACAACCCAGATTCAACAT
                      ____________________________________________________________
consensus AGAGTGAACCCCAGCGAGAGAACTACGAGACTGACAAGAGCGACAACCCAGATTCAACAT
 
. : . : . : . : . : . :
rJMFF019N21+ CGGACAACAAAGGGAATCTTTAAAGCGTGAGAAAAGATGTCCACATTGAAGCATTTTGAG
rJMSF042L23+ CGGACAACAAAGGGAATCTTTAAAGCGTGAGAAAAGATGTCCACATTGAAGCATTTTGAG
                      ____________________________________________________________
consensus CGGACAACAAAGGGAATCTTTAAAGCGTGAGAAAAGATGTCCACATTGAAGCATTTTGAG
 
. : . : . : . : . : . :
rJMFF019N21+ ATCACGATCGCCAACCAAGTTCCATTCTGAATGTTTGATCTGCCATCTACACAGCCTAAA
rJMSF042L23+ ATCACGATCGCCAACCAAGTTCCATTCTGAATGTTTGATCTGCCATCTACACAGCCTAAA
                      ____________________________________________________________
consensus ATCACGATCGCCAACCAAGTTCCATTCTGAATGTTTGATCTGCCATCTACACAGCCTAAA
 
. : . : . : . : . : . :
rJMFF019N21+ GCTGGGGGGAGGACATTGAATTGGTTGAAACCATAAAAAATAGATAGGGTTTTCATATAT
rJMSF042L23+ GCTGGGGGGAGGACATTGAATTGGTTGAAACCATAAAAAATAGATAGGGTTTTCATATAT
                      ____________________________________________________________
consensus GCTGGGGGGAGGACATTGAATTGGTTGAAACCATAAAAAATAGATAGGGTTTTCATATAT
 
. : . : . : . : . : . :
rJMFF019N21+ TCTTCCATTTTGGAAAATTCTTGATTGTATGCAAAAGATAGATAGGAAAATGAATGGTGT
rJMSF042L23+ TCTTCCATTTTGGAAAATTCTTGATTGTATGCAAAAGATAGATAGGAAAATGAATGGTGT
                      ____________________________________________________________
consensus TCTTCCATTTTGGAAAATTCTTGATTGTATGCAAAAGATAGATAGGAAAATGAATGGTGT
 
. : . : . : . : . : . :
rJMFF019N21+ ATGAAAGTGGTGGCC
rJMSF042L23+ ATGAAAGTGGTGGCCTTGTGAAGATGATATTTTCAGGAGGGTTGTGTACAGAAAATACTT
                      ____________________________________________________________
consensus ATGAAAGTGGTGGCCTTGTGAAGATGATATTTTCAGGAGGGTTGTGTACAGAAAATACTT