Previous Contig 013436:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF034I22Sequence668006953 (2)pir|G86319|G863194e-64F25I16.5 protein - Arabidopsis thaliana>gb:AE005172_890821 Arabidopsis thaliana 644013436 (2)
JMSF042L20Sequence806006953 (2)pir|G86319|G863194e-85F25I16.5 protein - Arabidopsis thaliana>gb:AE005172_890821 Arabidopsis thaliana 663013436 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034I22+ CAAACAGGAGATGCTACAGCTGGAATCAGAAACCCACCCACCACAGATGCTTC
                      ____________________________________________________________
consensus CAAACAGGAGATGCTACAGCTGGAATCAGAAACCCACCCACCACAGATGCTTC
 
. : . : . : . : . : . :
rJMSF034I22+ ACTGTCCCAGGAGCTCCCTGGAACCTCAAAACTATTTGCGGAACCTGAACCCAATTTGGA
rJMSF042L20+ GGA
                      ____________________________________________________________
consensus ACTGTCCCAGGAGCTCCCTGGAACCTCAAAACTATTTGCGGAACCTGAACCCAATTTGGA
 
. : . : . : . : . : . :
rJMSF034I22+ AACTAGTGAGGCAAATAACGCACCTAGGTCTATTGCTGATCTCTCTAAGGAGAATACTTC
rJMSF042L20+ AACTAGTGAGGCAAATAACGCACCTAGGTCTATTGCTGATCTCTCTAAGGAGAATACTTC
                      ____________________________________________________________
consensus AACTAGTGAGGCAAATAACGCACCTAGGTCTATTGCTGATCTCTCTAAGGAGAATACTTC
 
. : . : . : . : . : . :
rJMSF034I22+ CATTGCTGAGAATAACACCACTCTATCCTTAAACTAAGGTCTTCAGGATAGTTTTTGACG
rJMSF042L20+ CATTGCTGAGAATAACACCACTCTATCCTTAAACTAAGGTCTTCAGGATAGTTTTTGACG
                      ____________________________________________________________
consensus CATTGCTGAGAATAACACCACTCTATCCTTAAACTAAGGTCTTCAGGATAGTTTTTGACG
 
. : . : . : . : . : . :
rJMSF034I22+ GTAGAAATTAACAAATTGTACAGTTAGAGACGGGATCATGGAGGATCTTACTTGCCAAGT
rJMSF042L20+ GTAGAAATTAACAAATTGTACAGTTAGAGACGGGATCATGGAGGATCTTACTTGCCAAGT
                      ____________________________________________________________
consensus GTAGAAATTAACAAATTGTACAGTTAGAGACGGGATCATGGAGGATCTTACTTGCCAAGT
 
. : . : . : . : . : . :
rJMSF034I22+ GTGAAGGAATTAATTATTCTACGATAGGGATGACCAGTTTGGTTGTATCGAGGTTCCTCC
rJMSF042L20+ GTGAAGGAATTAATTATTCTACGATAGGGATGACCAGTTTGGTTGTATCGAGGTTCCTCC
                      ____________________________________________________________
consensus GTGAAGGAATTAATTATTCTACGATAGGGATGACCAGTTTGGTTGTATCGAGGTTCCTCC
 
. : . : . : . : . : . :
rJMSF034I22+ CAACGGTGGTGATTATTTCTGTTCTGACTTTACATCTTCATCCCACGGATAGGGGTGGCA
rJMSF042L20+ CAACGGTGGTGATTATTTCTGTTCTGACTTTACATCTTCATCCCACGGATAGGGGTGGCA
                      ____________________________________________________________
consensus CAACGGTGGTGATTATTTCTGTTCTGACTTTACATCTTCATCCCACGGATAGGGGTGGCA
 
. : . : . : . : . : . :
rJMSF034I22+ TATCTTGAACCACCCGCCCGCTTCCCTTCCTCGTTTTCCTGGGCTGAAAGTGTGACTTGA
rJMSF042L20+ TATCTTGAACCACCCGCCCGCTTCCCTTCCTCGTTTTCCTGGGCTGAAAGTGTGACTTGA
                      ____________________________________________________________
consensus TATCTTGAACCACCCGCCCGCTTCCCTTCCTCGTTTTCCTGGGCTGAAAGTGTGACTTGA
 
. : . : . : . : . : . :
rJMSF034I22+ ACCCTTTGATGTTGTTTTTGCTGGTGGTTGGTGACACCCAACCTAGTCCTCTTACCTTTG
rJMSF042L20+ ACCCTTTGATGTTGTTTTTGCTGGTGGTTGGTGACACCCAACCTAGTCCTCTTACCTTTG
                      ____________________________________________________________
consensus ACCCTTTGATGTTGTTTTTGCTGGTGGTTGGTGACACCCAACCTAGTCCTCTTACCTTTG
 
. : . : . : . : . : . :
rJMSF034I22+ ACTTCTAGGTTGTTCAAAATTGTGATCAGTGCTATTATTAGCTACCTTTTTCCAGGAGCA
rJMSF042L20+ ACTTCTAGGTTGTTCAAAATTGTGATCAGTGCTATTATTAGCTACCTTTTTCCAGGAGCA
                      ____________________________________________________________
consensus ACTTCTAGGTTGTTCAAAATTGTGATCAGTGCTATTATTAGCTACCTTTTTCCAGGAGCA
 
. : . : . : . : . : . :
rJMSF034I22+ CTATTTTGGATACTGAATTTCTCTAATGTTTAGTTTGTTTATTCATAGTGT
rJMSF042L20+ CTATTTTGGATACTGAATTTCTCTAATGTTTAGTTTGTTTATTCATAGTGTTGGTCAACC
                      ____________________________________________________________
consensus CTATTTTGGATACTGAATTTCTCTAATGTTTAGTTTGTTTATTCATAGTGTTGGTCAACC
 
. : . : . : . : . : . :
rJMSF042L20+ TGAATTAGATAATCTTGTATAAATGTGGATTCTACTATCCCAATCTTGAGATTGTGAGTA
                      ____________________________________________________________
consensus TGAATTAGATAATCTTGTATAAATGTGGATTCTACTATCCCAATCTTGAGATTGTGAGTA
 
. : . : . : . : . : . :
rJMSF042L20+ TACCTCATCAACCATAATGGATAACTAATCTCAGGTGGAAGGGAACTGATTCACTCAGAA
                      ____________________________________________________________
consensus TACCTCATCAACCATAATGGATAACTAATCTCAGGTGGAAGGGAACTGATTCACTCAGAA