Previous Contig 013432:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024N21Sequence501013432 (8)sp|Q9M337|R21B_ARATH5e-3440S ribosomal protein S21-2.>pir|T45929|T45929 40S ribosomal protein S21 homolog568013432 (8)sp|Q9M337|R21B_ARATH7e-3440S ribosomal protein S21-2.>pir|T45929|T45929 40S ribosomal protein S21 homolog
JMFN040D22Sequence128013432 (8)
JMSF005A01Sequence262013432 (8)sp|P35687|RS21_ORYSA1e-1140S ribosomal protein S21.>pir|S38357|S38357 ribosomal protein S21, cytosolic -
JMSF005A03Sequence266004663 (3)gb:AY663787_16205903e-20Fragaria x ananassa putative UDP-rhamnose:rhamnosyltransferase (srt1) mRNA, comp339013432 (8)gb:AY086689_15717334e-21Arabidopsis thaliana clone 26837 mRNA, complete sequence.
JMSF035C02Sequence568013432 (8)sp|P35687|RS21_ORYSA2e-3440S ribosomal protein S21.>pir|S38357|S38357 ribosomal protein S21, cytosolic - 520013432 (8)sp|P35687|RS21_ORYSA2e-3440S ribosomal protein S21.>pir|S38357|S38357 ribosomal protein S21, cytosolic -
JMSF042K24Sequence496013432 (8)sp|P35687|RS21_ORYSA1e-3440S ribosomal protein S21.>pir|S38357|S38357 ribosomal protein S21, cytosolic -

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF005A01- GGGGGTT
                      ____________________________________________________________
consensus GGGGGTT
 
. : . : . : . : . : . :
JMSF005A01- TTGGTTGTGCGACGAATATAAGCCAACCTAACGGCTAACGCCTCTGCTCTTTCTTCTCGG
rJMSF035C02+ GCTCTTTCTTCTCGG
JMSF035C02- GCTCTTTCTTCTCGG
rJMSF042K24+ GCTCTTTCTTCTCGG
                      ____________________________________________________________
consensus TTGGTTGTGCGACGAATATAAGCCAACCTAACGGCTAACGCCTCTGCTCTTTCTTCTCGG
 
. : . : . : . : . : . :
JMSF005A01- TCGCAGCTTCGCCATCTTCTCGCTCCCATTTTTGGTGCTTTAACATTGTACATTTTTGCT
JMFN040D22- CCATCTTCTCGCTCCCATTTTTGGTGCTTTAACATTGTACATTTTTGCT
rJMSF035C02+ TCGCAGCTTCGCCATCTTCTCGCTCCCATTTTTGGTGCTTTAACATTGTACATTTTTGCT
JMFF024N21- TTTTGCT
JMSF035C02- TCGCAGCTTCGCCATCTTCTCGCTCCCATTTTTGGTGCTTTAACATTGTACATTTTTGCT
rJMFF024N21+ TTTTGCT
rJMSF042K24+ TCGCAGCTTCGCCATCTTCTCGCTCCCATTTTTGGTGCTTTAACATTGTACATTTTTGCT
                      ____________________________________________________________
consensus TCGCAGCTTCGCCATCTTCTCGCTCCCATTTTTGGTGCTTTAACATTGTACATTTTTGCT
 
. : . : . : . : . : . :
JMSF005A01- AGTATCAAATCACTTTGCTAAGATGCAGAACGACGAGGGACAAAATATGGATCTGTACAT
JMFN040D22- AGTATTAAATCACTTTGCTAAGATGCAGAACGACGAGGGACAAAATATGGATCTGTACAT
rJMSF035C02+ AGTATCAAATCACTTTGCTAAGATGCAGAACGACGAGGGACAAAATATGGATCTGTACAT
JMFF024N21- TGTTTCAAATCACGTTGCTAAGATGCAGAACGATGAGGGACAAAATATGGATCTCTATAT
JMSF035C02- AGTATCAAATCACTTTGCTAAGATGCAGAACGACGAGGGACAAAATATGGATCTGTACAT
rJMFF024N21+ TGTTTCAAATCACGTTGCTAAGATGCAGAACGATGAGGGACAAAATATGGATCTCTATAT
rJMSF042K24+ AGTATCAAATCACTTTGCTAAGATGCAGAACGACGAGGGACAAAATATGGATCTGTACAT
                      ____________________________________________________________
consensus AGTATCAAATCACTTTGCTAAGATGCAGAACGACGAGGGACAAAATATGGATCTGTACAT
 
. : . : . : . : . : . :
JMSF005A01- TCCGAGGAAGTGCTCGGCCACAAATAGGCTGATCACTTCTAAGGATCATGCATCTGTCCA
JMFN040D22- TCCGAGGAAGTGCTCGGCC
rJMSF035C02+ TCCGAGGAAGTGCTCGGCCACAAATAGGCTGATCACTTCTAAGGATCATGCATCTGTCCA
JMFF024N21- CCCGAGGAAGTGCTCGGCCACAAATAGGCTGATCACTTCTAAGGATCATGCATCTGTCCA
rJMSF005A03+ TAAGGATCATGCATCTGTCCA
JMSF035C02- TCCGAGGAAGTGCTCGGCCACAAATAGGCTGATCACTTCTAAGGATCATGCATCTGTCCA
rJMFF024N21+ CCCGAGGAAGTGCTCGGCCACAAATAGGCTGATCACTTCTAAGGATCATGCATCTGTCCA
rJMSF042K24+ TCCGAGGAAGTGCTCGGCCACAAATAGGCTGATCACTTCTAAGGATCATGCATCTGTCCA
                      ____________________________________________________________
consensus TCCGAGGAAGTGCTCGGCCACAAATAGGCTGATCACTTCTAAGGATCATGCATCTGTCCA
 
. : . : . : . : . : . :
JMSF005A01- GATTAATGTTGGTCA
rJMSF035C02+ GATTAATGTTGGTCATTTGAATGAGAATGGTGTATATGATGGAAAGTACACCACCTTTGC
JMFF024N21- GATAAATGTTGGTCATTTGAATGAGAATGGCGTATATGATGGAAAGTACACCACTTTTGC
rJMSF005A03+ GATTAATGTTGGTCATTTGAATGAGAATGGTGNATATGATGGAAAGTACACCACCTTTGC
JMSF035C02- GATTAATGTTGGTCATTTGAATGAGAATGGTGTATATGATGGAAAGTACACCACCTTTGC
rJMFF024N21+ GATAAATGTTGGTCATTTGAATGAGAATGGCGTATATGATGGAAAGTACACCACTTTTGC
rJMSF042K24+ GATTAATGTTGGTCATTTGAATGAGAATGGTGTATATGATGGAAAGTACACCACCTTTGC
                      ____________________________________________________________
consensus GATTAATGTTGGTCATTTGAATGAGAATGGTGTATATGATGGAAAGTACACCACCTTTGC
 
. : . : . : . : . : . :
rJMSF035C02+ TTTGTGTGGATTTATTCGTGCACAGGGCGATGCAGATAGTGGTCTTGATAGGCTCTGGCA
JMFF024N21- TTTGTGTGGATTTATTCGTGCGCAGGGAGATGCAGACAGTGGTCTTGATAGGCTCTGGCA
rJMSF005A03+ TTTGTGTGGATTTATTCGTGCACAGGGCGATGCAGATAGTGGTCNNGATAGGCTCTGGCA
JMSF035C02- TTTGTGTGGATTTATTCGTGCACAGGGCGATGCAGATAGTGGTCTTGATAGGCTCTGGCA
rJMFF024N21+ TTTGTGTGGATTTATTCGTGCGCAGGGAGATGCAGACAGTGGTCTTGATAGGCTCTGGCA
rJMSF042K24+ TTTGTGTGGATTTATTCGTGCACAGGGCGATGCAGATAGTGGTCTTGATAGGCTCTGGCA
                      ____________________________________________________________
consensus TTTGTGTGGATTTATTCGTGCACAGGGCGATGCAGATAGTGGTCTTGATAGGCTCTGGCA
 
. : . : . : . : . : . :
rJMSF035C02+ GAAAAAGAAAGTTGAAGTCCGCCAACAGTGATGTCTTCTGGTGG
JMFF024N21- GAAGAAGAAAGTCGAAGCCCGCGAACAGTAATGTCTTTTGGTGG
rJMSF005A03+ GAAAAAGAAAGTTGAAGTCCGCCAACAGTGATGTCTTCTGGTGG
JMSF035C02- GAAAAAGAAAGTTGAAGTCCGCCAACAGTGATGTCTTCTGGTGG
rJMFF024N21+ GAAGAAGAAAGTCGAAGCCCGCGAACAGTAATGTCTTTTGGTGG
rJMSF042K24+ GAAAAAGAAAGTTGAAGTCCGCCAACAGTGATGTCTTCTGGTGGCTGCGTTTACTGTTGT
                      ____________________________________________________________
consensus GAAAAAGAAAGTTGAAGTCCGCCAACAGTGATGTCTTCTGGTGGCTGCGTTTACTGTTGT
 
. : . : . : . : . : . :
rJMSF042K24+ GCACATTGTGATGTGCGTTTGGTCTGGTTTTACAATGCCGTACACTCTAAATCATATCCT
                      ____________________________________________________________
consensus GCACATTGTGATGTGCGTTTGGTCTGGTTTTACAATGCCGTACACTCTAAATCATATCCT
 
. : . : . : . : . : . :
rJMSF042K24+ TGATTTTGAAGTATGAGTTTTGCACAAATATTTGTTGTCTTGTGTTAGAGTCTACTTAAA
                      ____________________________________________________________
consensus TGATTTTGAAGTATGAGTTTTGCACAAATATTTGTTGTCTTGTGTTAGAGTCTACTTAAA