Previous Contig 013426:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030P13Sequence667013426 (4)gb:ATU81498_15573094e-60Arabidopsis thaliana phenylalkylamine binding protein homolog mRNA, complete cds772013426 (4)gb:ATU81498_15573092e-78Arabidopsis thaliana phenylalkylamine binding protein homolog mRNA, complete cds
JMSF042K08Sequence750013426 (4)gb:ATU81498_15573096e-77Arabidopsis thaliana phenylalkylamine binding protein homolog mRNA, complete cds746013426 (4)gb:ATU81498_15573098e-42Arabidopsis thaliana phenylalkylamine binding protein homolog mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030P13- GAGGGCGTGGGAGTCTATTTCCCTCTCCTCACTGTCTCAGATTTCAAACTTGA
JMSF042K08- AAACTTGA
                      ____________________________________________________________
consensus GAGGGCGTGGGAGTCTATTTCCCTCTCCTCACTGTCTCAGATTTCAAACTTGA
 
. : . : . : . : . : . :
JMSF030P13- GTCCATTGCAGCTTTCAGATTTCAGATCTCAGTCCATCGGACTCCTCACTAATCCGGTTT
JMSF042K08- GTCCATTGCAGCTTTCAGATTTCAGATCTCAGTCCATCGGACTCCTCACTAATCCGGTTT
                      ____________________________________________________________
consensus GTCCATTGCAGCTTTCAGATTTCAGATCTCAGTCCATCGGACTCCTCACTAATCCGGTTT
 
. : . : . : . : . : . :
JMSF030P13- GCTTCTGCTCATATATATCAAGGCAGCTACAGGTGGAGTTTGACACCGATGGAAATGCAG
JMSF042K08- GCTTCTGCTCATATATATCAAGGCAGCTACAGGTGGAGTTTGACACCGATGGAAATGCAG
rJMSF030P13+ GGAGTTTGACACCGA-NGAAATGCAG
                      ____________________________________________________________
consensus GCTTCTGCTCATATATATCAAGGCAGCTACAGGTGGAGTTTGACACCGATGGAAATGCAG
 
. : . : . : . : . : . :
JMSF030P13- GAAGGAGGTCACCCATACGTTCCTAGAGACCTAAAATTGCCTGGGTTTGTGCCTTGTTTC
JMSF042K08- GAAGGAGGTCACCCATACGTTCCTAGAGACCTAAAATTGCCTGGGTTTGTGCCTTGTTTC
rJMSF030P13+ GAAGGAGGTCACCCATACGTTCCTAGAGACCTAAAATTGCCTGGGTTTGTGCCTTGTTTC
                      ____________________________________________________________
consensus GAAGGAGGTCACCCATACGTTCCTAGAGACCTAAAATTGCCTGGGTTTGTGCCTTGTTTC
 
. : . : . : . : . : . :
JMSF030P13- CTCACACAATTGGACATTGTTGGTGTGTATGGAGGTGTTTCTACACTGGTTGTTGCATTC
JMSF042K08- CTCACACAATTGGACATTGTTGGTGTGTATGGAGGTGTTTCTACACTGGTTGTTGCATTC
rJMSF030P13+ CTCACACAATTGGACATTGTTGGTGTGTATGGAGGTGTTTCTACACTGGTTGTTGCATTC
                      ____________________________________________________________
consensus CTCACACAATTGGACATTGTTGGTGTGTATGGAGGTGTTTCTACACTGGTTGTTGCATTC
 
. : . : . : . : . : . :
JMSF030P13- ATGTGGATCTTCTCTGGGCGGTTCCCTAAAATATCAAAGGGCGACAGGTTGCTCATGTGC
JMSF042K08- ATGTGGATCTTCTCTGGGCGGTTCCCTAAAATATCAAAGGGCGACAGGTTGCTCATGTGC
rJMSF030P13+ ATGTGGATCTTCTCTGGGCGGTTCCCTAAAATATCAAAGGGCGACAGGTTGCTCATGTGC
                      ____________________________________________________________
consensus ATGTGGATCTTCTCTGGGCGGTTCCCTAAAATATCAAAGGGCGACAGGTTGCTCATGTGC
 
. : . : . : . : . : . :
JMSF030P13- TGGTGGATATTCACTGGCCTTACACACATGATCCTTGAGGGCTACTTTGTTTTCTCTCCT
JMSF042K08- TGGTGGATATTCACTGGCCTTACACACATGATCCTTGAGGGCTACTTTGTTTTCTCTCCT
rJMSF030P13+ TGGTGGATATTCACTGGCCTTACACACATGATCCTTGAGGGCTACTTTGTTTTCTCTCCT
                      ____________________________________________________________
consensus TGGTGGATATTCACTGGCCTTACACACATGATCCTTGAGGGCTACTTTGTTTTCTCTCCT
 
. : . : . : . : . : . :
JMSF030P13- AATTTCTACAAGGAAAAGACTCCCGTTTACCTTGCAGAAGTTTGGAAGGAGTACAGCAAG
JMSF042K08- AATTTCTACAAGGAAAAGACTCCCGTTTACCTTGCAGAAGTTTGGAAGGAGTACAGCAAG
rJMSF030P13+ AATTTCTACAAGGAAAAGACTCCCGTTTACCTTGCAGAAGTTTGGAAGGAGTACAGCAAG
rJMSF042K08+ TTGGAAGGAGTACAGCAAG
                      ____________________________________________________________
consensus AATTTCTACAAGGAAAAGACTCCCGTTTACCTTGCAGAAGTTTGGAAGGAGTACAGCAAG
 
. : . : . : . : . : . :
JMSF030P13- GGAGATTCTCGGTATGCAGCACGTGATTCTGCTGTTATTTCAGTTGAAGGAATCACAGCC
JMSF042K08- GGAGATTCTCGGTATGCAGCACGTGATTCTGCTGTTATTTCAGTTGAAGGAATCACAGCC
rJMSF030P13+ GGAGATTCTCGGTATGCAGCACGTGATTCTGCTGTTATTTCAGTTGAAGGAATCACAGCC
rJMSF042K08+ GGAGATTCTCGGTATGCAGCACGTGATTCTGCTGTTATTTCAGTTGAAGGAATCACAGCC
                      ____________________________________________________________
consensus GGAGATTCTCGGTATGCAGCACGTGATTCTGCTGTTATTTCAGTTGAAGGAATCACAGCC
 
. : . : . : . : . : . :
JMSF030P13- GTTCTAGAGGGACCAGCATGTCTTCTTGCAGTGTATGCTATAGCTACAAAGAAGTCGTAT
JMSF042K08- GTTCTAGAGGGACCAGCATGTCTTCTTGCAGTGTATGCTATAGCTACAAAGAAGTCGTAT
rJMSF030P13+ GTTCTAGAGGGACCAGCATGTCTTCTTGCAGTGTATGCTATAGCTACAAAGAAGTCGTAT
rJMSF042K08+ GTTCTAGAGGGACCAGCATGTCTTCTTGCAGTGTATGCTATAGCTACAAAGAAGTCGTAT
                      ____________________________________________________________
consensus GTTCTAGAGGGACCAGCATGTCTTCTTGCAGTGTATGCTATAGCTACAAAGAAGTCGTAT
 
. : . : . : . : . : . :
JMSF030P13- AGGTATATACTACAGGTGGCTATTTCTTTGGGCCAGCTCTATGGTACTGCTGTATATTTC
JMSF042K08- AGGTATATACTACAGGTGGCTATTTCTTTGGGCCAGCTCTATGGTACTGCTGTATATTTC
rJMSF030P13+ AGGTATATACTACAGGTGGCTATTTCTTTGGGCCAGCTCTATGGTACTGCTGTATATTTC
rJMSF042K08+ AGGTATATACTACAGGTGGCTATTTCTTTGGGCCAGCTCTATGGTACTGCTGTATATTTC
                      ____________________________________________________________
consensus AGGTATATACTACAGGTGGCTATTTCTTTGGGCCAGCTCTATGGTACTGCTGTATATTTC
 
. : . : . : . : . : . :
JMSF030P13- ATTACAGCTGTCTT
JMSF042K08- ATTACAGCTGTCTTGGAGGGTGATAATTTTGCTGTAAGCCCCTTTTATTACTTCTGGTAC
rJMSF030P13+ ATTACAGCTGTCTTGGAGGGTGATAATTTTGCTGTAAGCCCCTTTTATTACTTCTGGTAC
rJMSF042K08+ ATTACAGCTGTCTTGGAGGGTGATAATTTTGCTGTAAGCCCCTTTTATTACTTCTGGTAC
                      ____________________________________________________________
consensus ATTACAGCTGTCTTGGAGGGTGATAATTTTGCTGTAAGCCCCTTTTATTACTTCTGGTAC
 
. : . : . : . : . : . :
JMSF042K08- TATGTCTTTGCAAATTCCTTCTGGGTCTGGATACCCACAATCATAATCGTCCGTTGCTGG
rJMSF030P13+ TATGTCTTTGCAAATTCCTTCTGGGTCTGGATACCCACAATCATAATCGTCCGTTGCTGG
rJMSF042K08+ TATGTCTTTGCAAATTCCTTCTGGGTCTGGATACCCACAATCATAATCGTCCGTTGCTGG
                      ____________________________________________________________
consensus TATGTCTTTGCAAATTCCTTCTGGGTCTGGATACCCACAATCATAATCGTCCGTTGCTGG
 
. : . : . : . : . : . :
JMSF042K08- AGGAGAATTAGTTCTGCTGTC
rJMSF030P13+ AGGAGAATTAGTTCTGCTGTCCAGATACAAGACCAGACAAAGACCAAGACTCGCTGAGGC
rJMSF042K08+ AGGAGAATTAGTTCTGCTGTCCAGATACAAGACCAGACAAAGACCAAGACTCGCTGAGGC
                      ____________________________________________________________
consensus AGGAGAATTAGTTCTGCTGTCCAGATACAAGACCAGACAAAGACCAAGACTCGCTGAGGC
 
. : . : . : . : . : . :
rJMSF030P13+ CATCTTTTCATTTGTTGTGGTACTGAATTTATTTGAGTTTTGTGGGAACAATACAGGCTG
rJMSF042K08+ CATCTTTTCATTTGTTGTGGTACTGAATTTATTTGAGTTTTGTGGGAACAATACAGGCTG
                      ____________________________________________________________
consensus CATCTTTTCATTTGTTGTGGTACTGAATTTATTTGAGTTTTGTGGGAACAATACAGGCTG
 
. : . : . : . : . : . :
rJMSF030P13+ TTGGGACTCATTTCTTTAGAGATAGAA
rJMSF042K08+ TTGGGACTCATTTCTTTAGAGATAGAACTGTAATGCCCTGGTAATAGTGATATATTTAAA
                      ____________________________________________________________
consensus TTGGGACTCATTTCTTTAGAGATAGAACTGTAATGCCCTGGTAATAGTGATATATTTAAA
 
. : . : . : . : . : . :
rJMSF042K08+ AGGAACTTTTGGATTCGTTTTGGCTTCATTCCAGTCCCATTCATATAATGGGGTTGTTTG
                      ____________________________________________________________
consensus AGGAACTTTTGGATTCGTTTTGGCTTCATTCCAGTCCCATTCATATAATGGGGTTGTTTG
 
. : . : . : . : . : . :
rJMSF042K08+ GTAGGATAGAATTGCAATTCCATTCCTACCAAACTCCATGAAGTTGCAATTTCATGGTTT
                      ____________________________________________________________
consensus GTAGGATAGAATTGCAATTCCATTCCTACCAAACTCCATGAAGTTGCAATTTCATGGTTT
 
. : . : . : . : . : . :
rJMSF042K08+ GATTGGAGGGAATTGCAATTTCACAGAATTACAATTCTTAAGGTTCCCTCTAGGAATTGC
                      ____________________________________________________________
consensus GATTGGAGGGAATTGCAATTTCACAGAATTACAATTCTTAAGGTTCCCTCTAGGAATTGC
 
. : . : . : . : . : . :
rJMSF042K08+ AATTCCACACTGTGAAATTGTAATTTTATGATAAATTACCCATTTTATTATTTTTATGAT
                      ____________________________________________________________
consensus AATTCCACACTGTGAAATTGTAATTTTATGATAAATTACCCATTTTATTATTTTTATGAT