Previous Contig 013422:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018C23Sequence240019062793013422 (3)gb:AP003758_18330133e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ15
JMSF040O09Sequence655013422 (3)gb:AB019225_15140472e-14Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1O13.902013315 (2)gb:AY139975_15824177e-55Arabidopsis thaliana unknown protein mRNA, complete cds.
JMSF042I08Sequence742013422 (3)gb:AP003758_18330136e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ15

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040O09+ TTACCACAACCATGTTCTGGAACTGGTGATGAGCATAGTGGACGAGCAACTT
                      ____________________________________________________________
consensus TTACCACAACCATGTTCTGGAACTGGTGATGAGCATAGTGGACGAGCAACTT
 
. : . : . : . : . : . :
JMSF040O09+ GGTCTATAGAGGAAGACGTGATTCTTGCAAAAGCATGGATCAAATTTAGCGAGGATCGAA
rJMSF018C23+ TTAGCGAGGATCGAA
                      ____________________________________________________________
consensus GGTCTATAGAGGAAGACGTGATTCTTGCAAAAGCATGGATCAAATTTAGCGAGGATCGAA
 
. : . : . : . : . : . :
JMSF040O09+ AGAAGCTAAAAAATTCACATGGGAATGCTACCCTTTGGCAACTTATTGAGAAGTACTACA
rJMSF018C23+ NGAAGCTAAAAAATTCACATGGGAATGCTACCCTTTGGCAACTTATTGAGAAGTACTACA
rJMSF042I08+ CAACTTATTGAGAAGTACTACA
                      ____________________________________________________________
consensus AGAAGCTAAAAAATTCACATGGGAATGCTACCCTTTGGCAACTTATTGAGAAGTACTACA
 
. : . : . : . : . : . :
JMSF040O09+ ATGAGTATCGTCCTACTGGTACAGTGAAGAGAGATCGGGCGAAACTAAAAACTCACTGGA
rJMSF018C23+ ATGAGTATCGTCCTACTGGTACAGTGAAGAGAGATCGGGCGAAACTAAAAACTCACTGGA
rJMSF042I08+ ATGAGTATCGTCCTACTGGTACAGTGAAGAGAGATCGGGCGAAACTAAAAACTCACTGGA
                      ____________________________________________________________
consensus ATGAGTATCGTCCTACTGGTACAGTGAAGAGAGATCGGGCGAAACTAAAAACTCACTGGA
 
. : . : . : . : . : . :
JMSF040O09+ ATCAAGCTCGTATGAAGATTACTGCTTTCAATACAAGCTATAATGAATTACTTAGTGCGC
rJMSF018C23+ ATCAAGCTCGTATGAAGATTACTGCTTTCAATACAAGCTATAATGAATTACTTAGTGCGC
rJMSF042I08+ ATCAAGCTCGTATGAAGATTACTGCTTTCAATACAAGCTATAATGAATTACTTAGTGCGC
                      ____________________________________________________________
consensus ATCAAGCTCGTATGAAGATTACTGCTTTCAATACAAGCTATAATGAATTACTTAGTGCGC
 
. : . : . : . : . : . :
JMSF040O09+ GCCCAGATGGTTGCAGTGACGAGGACATACTATTGCAAACTCATGAAGAATACAAGGCAA
rJMSF018C23+ GCCCAGATGGTTGCAGTGACGAGGACATACTATTGCAAACTCATGAAGAATACAAGGCAA
rJMSF042I08+ GCCCAGATGGTTGCAGTGACGAGGACATACTATTGCAAACTCATGAAGAATACAAGGCAA
                      ____________________________________________________________
consensus GCCCAGATGGTTGCAGTGACGAGGACATACTATTGCAAACTCATGAAGAATACAAGGCAA
 
. : . : . : . : . : . :
JMSF040O09+ CACACAAGGGCATCCACTTTCCCTACTTACACTTGTGGAATATTGTCAGATATTTCCCAA
rJMSF018C23+ CACACAAGGGCATCCACTTTCCCTACTTACACTTGTGGAATATTGTCAGATATTTCCCAA
rJMSF042I08+ CACACAAGGGCATCCACTTTCCCTACTTACACTTGTGGAATATTGTCAGATATTTCCCAA
                      ____________________________________________________________
consensus CACACAAGGGCATCCACTTTCCCTACTTACACTTGTGGAATATTGTCAGATATTTCCCAA
 
. : . : . : . : . : . :
JMSF040O09+ TGTGGGCAACAAATGGCCGCAAGTCAAAGAAGAAGAAGACTACCGAGCAAGGACAACACA
rJMSF018C23+ TGTGGGCAACAAATGGCCGCAAGTCAAAGAAGAAGAAGACTACCGAGCAAGGACAACACA
rJMSF042I08+ TGTGGGCAACAAATGGCCGCAAGTCAAAGAAGAAGAAGACTACCGAGCAAGGACAACACA
                      ____________________________________________________________
consensus TGTGGGCAACAAATGGCCGCAAGTCAAAGAAGAAGAAGACTACCGAGCAAGGACAACACA
 
. : . : . : . : . : . :
JMSF040O09+ CGTCTTCTTCCAGTGCTGAGGACACTGTTGATGTGGATGAAGGCGAAGTTCACCCTCGTC
rJMSF018C23+ CGTCTTCTTCCAGTGCTGAGGACACTGTTGATGTGGATGAAGGCGAAGTTCACCCTCGTC
rJMSF042I08+ CGTCTTCTTCCAGTGCTGAGGACACTGTTGATGTGGATGAAGGCGAAGTTCACCCTCGTC
                      ____________________________________________________________
consensus CGTCTTCTTCCAGTGCTGAGGACACTGTTGATGTGGATGAAGGCGAAGTTCACCCTCGTC
 
. : . : . : . : . : . :
JMSF040O09+ CGGTTGAGCAAAAGGACATGGGGAGGAAAAGAAAAGCCCCGATTATAAATGTTGATCAAA
rJMSF018C23+ CGGTTGAGCAAAAGGACATGGGGAGGAAAAGAAAAGCCCCGATTATAAATGTTGATCAAA
rJMSF042I08+ CGGTTGAGCAAAAGGACATGGGGAGGAAAAGAAAAGCCCCGATTATAAATGTTGATCAAA
                      ____________________________________________________________
consensus CGGTTGAGCAAAAGGACATGGGGAGGAAAAGAAAAGCCCCGATTATAAATGTTGATCAAA
 
. : . : . : . : . : . :
JMSF040O09+ TCTCAAACACAATGCAAAAACAACTAGACAAGCTTGAGGAGTATAATTCATTGAAGG
rJMSF018C23+ TCTCAAACACAATGCAAAAACAACTAGACAAGCTTGAGGAGTATAATTCATTGAAGGCAA
rJMSF042I08+ TCTCAAACACAATGCAAAAACAACTAGACAAGCTTGAGGAGTATAATTCATTGAAGGCAA
                      ____________________________________________________________
consensus TCTCAAACACAATGCAAAAACAACTAGACAAGCTTGAGGAGTATAATTCATTGAAGGCAA
 
. : . : . : . : . : . :
rJMSF018C23+ GAGATACTTTTGTCAATGAATATCAAATCCTTATGAAGGACACTTCGACAATGACAGAAG
rJMSF042I08+ GAGATACTTTTGTCAATGAATATCAAATCCTTATGAAGGACACTTCGACAATGACAGAAG
                      ____________________________________________________________
consensus GAGATACTTTTGTCAATGAATATCAAATCCTTATGAAGGACACTTCGACAATGACAGAAG
 
. : . : . : . : . : . :
rJMSF018C23+ AGCAGCTCCAAACGCATCGCTATGCATGTGAAACTATTAAGAAGAGCTGGGGAATGTAGT
rJMSF042I08+ AGCAGCTCCAAACGCATCGCTATGCATGTGAAACTATTAAGAAGAGCTGGGGAATGTAGT
                      ____________________________________________________________
consensus AGCAGCTCCAAACGCATCGCTATGCATGTGAAACTATTAAGAAGAGCTGGGGAATGTAGT
 
. : . : . : . : . : . :
rJMSF018C23+ CGAGGGATCTTTTAATTTATGTGTAGTATATGTTTCGTGTAATTTTTGTTTATTTTAGGT
rJMSF042I08+ CGAGGGATCTTTTAATTTATGTGTAGTATATGTTTCGTGTAATTTTTGTTTATTTTAGGT
                      ____________________________________________________________
consensus CGAGGGATCTTTTAATTTATGTGTAGTATATGTTTCGTGTAATTTTTGTTTATTTTAGGT
 
. : . : . : . : . : . :
rJMSF018C23+ TGTAGTTTATTTGTAATCCATATATT
rJMSF042I08+ TGTAGTTTATTTGTAATCCATATATTNTGAGTTGGTGAATGCTATTTATTTCGCTTAACA
                      ____________________________________________________________
consensus TGTAGTTTATTTGTAATCCATATATTNTGAGTTGGTGAATGCTATTTATTTCGCTTAACA