Previous Contig 013411:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN018F22Sequence619013411 (6)gb:AB011479_15114436e-59Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNA5.
JMSF005M10Sequence314018441308013411 (6)gb:OSJN00048_16938455e-10Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0086B14, complete seque
JMSF005O12Sequence267013411 (6)gb:AK118442_18164201e-13Arabidopsis thaliana At4g24380 mRNA for unknown protein, complete cds, clone: RA306013411 (6)gb:OSJN00048_16938452e-13Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0086B14, complete seque
JMSF042G09Sequence826013411 (6)gb:AB011479_15114436e-72Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNA5.727013411 (6)gb:AB011479_15114434e-42Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNA5.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF005O12- GGGAAGATTCATTGTAACTACGTTGCGTCTAATTATTTTT
JMFN018F22- TTGCGTCTAATTATTTTT
                      ____________________________________________________________
consensus GGGAAGATTCATTGTAACTACGTTGCGTCTAATTATTTTT
 
. : . : . : . : . : . :
JMSF005O12- TGGGAAACAAAGAATTGAGAGAATATCTCAGCTCCTTCCTTCATCTAAAAATGGGAAACA
JMFN018F22- TGGGAAACAAAGAATTGAGAGAATATCTCAGCTCCTTCCTTCATCTAAAAATGGAAAACA
JMSF042G09- GGGAAACAAAGAATTGAGAGAATATCTCAGCTCCTTCCTTCATCTAAAAATGGAAAACA
                      ____________________________________________________________
consensus TGGGAAACAAAGAATTGAGAGAATATCTCAGCTCCTTCCTTCATCTAAAAATGGAAAACA
 
. : . : . : . : . : . :
JMSF005O12- ACCAAATAATCCACAAGAAACTCAGAGTTGTTTGCCTCCACGGCTTCCGAACAAGCGCCG
JMFN018F22- ACCAAATAATCCACAAGAAACTCAGAGTTGTTTGCCTCCACGGCTTCCGAACAAGCGCCG
JMSF042G09- ACCAAATAATCCACAAGAAACTCAGAGTTGTTTGCCTCCACGGCTTCCGAACAAGCGCCG
                      ____________________________________________________________
consensus ACCAAATAATCCACAAGAAACTCAGAGTTGTTTGCCTCCACGGCTTCCGAACAAGCGCCG
 
. : . : . : . : . : . :
JMSF005O12- AAATCCTCAAGAAATTGGTTCTCCGGTGGCCGGAATCCGTCCTCGACCGCCTAGATCTCC
JMFN018F22- AAATCCTCAAGAAATTGGTTCTCCGGTGGCCGGAATCCGTCCTCGACCGCCTAGATCTCC
JMSF042G09- AAATCCTCAAGAAATTGGTTCTCCGGTGGCCGGAATCCGTCCTCGACCGCCTAGATCTCC
rJMSF042G09+ TAGATCTCC
                      ____________________________________________________________
consensus AAATCCTCAAGAAATTGGTTCTCCGGTGGCCGGAATCCGTCCTCGACCGCCTAGATCTCC
 
. : . : . : . : . : . :
JMSF005O12- ACTTTCTCGACGCACCATTCCCCGCTCAGGGCAAGTCCACCGTCGAA
JMFN018F22- ACTTTCTCGACGCACCATTCCCCGCTCAGGGCAAGTCCACCGTCGAAGGCATCTTTGACC
JMSF042G09- ACTTTCTCGACGCACCATTCCCCGCTCAGGGCAAGTCCACCGTCGAAGGCATCTTTGACC
rJMSF042G09+ ANTTTCTCGACGCANCATTCCCCGNTCAGGGCAAGTCCACCGTCGAAGGCATCTTTGNCC
                      ____________________________________________________________
consensus ACTTTCTCGACGCACCATTCCCCGCTCAGGGCAAGTCCACCGTCGAAGGCATCTTTGACC
 
. : . : . : . : . : . :
JMFN018F22- CTCCTTACTTCGAATGGTTCCAAGCTGATAAGGAATTTAAAGAATATTACAAATTTGAAG
JMSF042G09- CTCCTTACTTCGAATGGTTCCAAGCTGATAAGGAATTTAAAGAATATTACAAATTTGAAG
rJMSF042G09+ CTCCTTACTTCGAATGGTTCCAAGCTGATAAGGAATTTAAAGAATATTACAAATTTGAAG
                      ____________________________________________________________
consensus CTCCTTACTTCGAATGGTTCCAAGCTGATAAGGAATTTAAAGAATATTACAAATTTGAAG
 
. : . : . : . : . : . :
JMFN018F22- AGTGCCTGGAATACATTGAGGATTATATGGTCAAAAATGGGCCCTTTGATGGAGTTCTTG
JMSF042G09- AGTGCCTGGAATACATTGAGGATTATATGGTCAAAAATGGGCCCTTTGATGGAGTTCTTG
rJMSF042G09+ AGTGCCTGGAATACATTGAGGATTATATGGTCAAAAATGGGCCCTTTGATGGAGTTCTTG
                      ____________________________________________________________
consensus AGTGCCTGGAATACATTGAGGATTATATGGTCAAAAATGGGCCCTTTGATGGAGTTCTTG
 
. : . : . : . : . : . :
JMFN018F22- GTTTTTCCCAGGGAGCAGTTTTAGCAGCAGCAATGCCAGGAATGCAGAGGGAAGGTGCAG
JMSF042G09- GTTTTTCCCAGGGAGCAGTTTTAGCAGCAGCAATGCCAGGAATGCAGAGGGAAGGTGCAG
rJMSF042G09+ GTTTTTCCCAGGGAGCAGTTTNAGCAGCAGCAATGCCAGGAANGCAGAGGGAAGGTGCAG
                      ____________________________________________________________
consensus GTTTTTCCCAGGGAGCAGTTTTAGCAGCAGCAATGCCAGGAATGCAGAGGGAAGGTGCAG
 
. : . : . : . : . : . :
JMFN018F22- CTTTGAGCAAAGCAGCAAAAATAAAGTTTGTGATAATAATATCTGGGGCTAAATTTGGAG
JMSF042G09- CTTTGAGCAAAGCAGCAAAAATAAAGTTTGTGATAATAATATCTGGGGCTAAATTTGGAG
rJMSF042G09+ CTTNGAGCAAAGCAGCAAAAATAAAGTTTGTGATAATAATATNTGGGGCTAAATTTGGAG
                      ____________________________________________________________
consensus CTTTGAGCAAAGCAGCAAAAATAAAGTTTGTGATAATAATATCTGGGGCTAAATTTGGAG
 
. : . : . : . : . : . :
JMFN018F22- GCCCCAAATTTGGTGTTCCAAAACTAGCTACCAATGCATTCTCACATCCACTTCATTGCC
JMSF042G09- GCCCCAAATTTGGTGTTCCAAAACTAGCTGCCAATGCATTCTCACATCCACTTCATTGCC
rJMSF042G09+ GCCCCAAATTNGGTGTTCCAAAACTAGCTGCCAATGCNTTCTCACATCCACTTCATTGCC
                      ____________________________________________________________
consensus GCCCCAAATTTGGTGTTCCAAAACTAGCTGCCAATGCATTCTCACATCCACTTCATTGCC
 
. : . : . : . : . : . :
JMFN018F22- CTTCCTTGCACTTCTTGGGTGAGACAGATTTCCAGAAAGAAG-AGGGAAAACTCTGCTGG
rJMSF005O12+ GGTGAGACAGATTTCCAGAAAGAAGAAGGGAAACTTCTGCTGG
rJMSF005M10+ GGTGAGACCGATTTCCAGAAAGAAGAAGGGAAACTTCTGCTGG
JMSF042G09- CTTCCTTGCACTTCTTGGGTGAGACAGATTTCCAGAAAGAAGAAGGGAAACTTCTGCTGG
rJMSF042G09+ CTTCCTTGCNCTTCNTGGGTGAGACAGATTTCCAGAAAGAAGAAGGGAAANTTCTGCTGG
                      ____________________________________________________________
consensus CTTCCTTGCACTTCTTGGGTGAGACAGATTTCCAGAAAGAAGAAGGGAAACTTCTGCTGG
 
. : . : . : . : . : . :
JMFN018F22- AG
rJMSF005O12+ AGTGCTTTGTGGATCCACATCTTATTCATCACCCCAAAGGACACACAGTACCAAGATTAG
rJMSF005M10+ AGTGCTTTGTNGATCCACATCTTATTCATCACCCCAAAGGACCCACAGTCCCAAGATTCG
JMSF042G09- AGTGCTTTGTGGATCCACATCTTATTCATCACCCCAAAGGACACACAGTACCAAGATTAG
rJMSF042G09+ AGTGCTTTGTGGATCCACATCTTNTTCATCACCCCAAAGGNCACACAGTNCCAAGATTAG
                      ____________________________________________________________
consensus AGTGCTTTGTGGATCCACATCTTATTCATCACCCCAAAGGACACACAGTACCAAGATTAG
 
. : . : . : . : . : . :
rJMSF005O12+ ACGAGGAAAGTGTTGGAACAATGCTTGGGTTCATCGACAAAATTGAGAAAATGGCAGTGC
rJMSF005M10+ ACGAGGAAAGTGTTGGACCAATGCTTGGGCTCATCGACAAAACTGAGAAAATGGCAGTGC
JMSF042G09- ACGAGGAAAGTGTTGGAACAATGCTTGGGTTCATCGACAAAATTGAGAAAATGGCAGTGC
rJMSF042G09+ NCGAGGAAAGTGTTGGAACAATGCNTGGGTTCATCGNCAAAATTGAGAAAATGGCAGTGC
                      ____________________________________________________________
consensus ACGAGGAAAGTGTTGGAACAATGCTTGGGTTCATCGACAAAATTGAGAAAATGGCAGTGC
 
. : . : . : . : . : . :
rJMSF005O12+ AGGAGGAAGGAAACTAGCCTAGGTTCAGCCTTAATG-ACTATATATGCCATGGTAATGAT
rJMSF005M10+ AGGAGGNAGGAACCTAGCCTANGTTCAGCCTTNATGCACTATATATG-CATGGTAATGAT
JMSF042G09- AGGAGGAAGGAAACTAGCCTAGGTTCAGCCTTAATG-ACTATATATG-CATGGTAATGAT
rJMSF042G09+ NGGAGGAAGGAAACTAGCCTNGGTTCAGCCTTAANG-ACTATATATG-CATGGTAATGAT
                      ____________________________________________________________
consensus AGGAGGAAGGAAACTAGCCTAGGTTCAGCCTTAATG-ACTATATATG-CATGGTAATGAT
 
. : . : . : . : . : . :
rJMSF005O12+ CTAAAGCAACATG
rJMSF005M10+ CTAANGCAACATG
JMSF042G09- CTAAAGCAACATGCAGTGTCTAATTAGTAACCATACTAATTAGGTTAA
rJMSF042G09+ CTAAAGCAACATGCAGTGTCTAATTAGTAACCATACTAATTAGGTTAAATAAAACTGTGT
                      ____________________________________________________________
consensus CTAAAGCAACATGCAGTGTCTAATTAGTAACCATACTAATTAGGTTAAATAAAACTGTGT
 
. : . : . : . : . : . :
rJMSF042G09+ TTAATCTTGTAATCCTAGTAATTCGTTATCTCGACCNCAAATACTTGTGACTTGGTACAA
                      ____________________________________________________________
consensus TTAATCTTGTAATCCTAGTAATTCGTTATCTCGACCNCAAATACTTGTGACTTGGTACAA