Previous Contig 013410:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF042G07Sequence786013410 (2)sp|P57108|GSTZ_EUPES8e-58Glutathione S-transferase zeta class (EC 2.5.1.18).>gb:AF263737_1781767 Euphorbi767013410 (2)gb:AY206003_15891609e-46Malva pusilla glutathione S-transferase Z1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF042G07- GGT
                      ____________________________________________________________
consensus GGT
 
. : . : . : . : . : . :
JMSF042G07- TGATCACTTGATCATGGCGGAGACAGGCGGCGGAGGAGAGTCGACCAAGCTTCAACTCTA
                      ____________________________________________________________
consensus TGATCACTTGATCATGGCGGAGACAGGCGGCGGAGGAGAGTCGACCAAGCTTCAACTCTA
 
. : . : . : . : . : . :
JMSF042G07- CTCCAACTGGGAGAGCTCTTGCGCTTGCCGCGTTAGGATTGCTCTCAATCTCAAAGGTCA
                      ____________________________________________________________
consensus CTCCAACTGGGAGAGCTCTTGCGCTTGCCGCGTTAGGATTGCTCTCAATCTCAAAGGTCA
 
. : . : . : . : . : . :
JMSF042G07- AGGACTGGATTACGAGTACAAAGCGGTTAACCTGCTCAAAGCCGAACATTTCAGCCCTGA
                      ____________________________________________________________
consensus AGGACTGGATTACGAGTACAAAGCGGTTAACCTGCTCAAAGCCGAACATTTCAGCCCTGA
 
. : . : . : . : . : . :
JMSF042G07- ATTTTTGAAGCTCAATCCCATGGGGTATGTGCCGGCATTGGTTGATGGAGACATTGTTAT
                      ____________________________________________________________
consensus ATTTTTGAAGCTCAATCCCATGGGGTATGTGCCGGCATTGGTTGATGGAGACATTGTTAT
 
. : . : . : . : . : . :
JMSF042G07- TTCAGACTCTTTTGCTATTTTGATGGTGAGATTTCGCCTTTACGCTAGTGTGGTGTTAAG
                      ____________________________________________________________
consensus TTCAGACTCTTTTGCTATTTTGATGGTGAGATTTCGCCTTTACGCTAGTGTGGTGTTAAG
 
. : . : . : . : . : . :
JMSF042G07- TTTGGTATTCTATACGGAATAACTTGTAAGTAATCATAATGTGCAGTATTTGGAAGAAAA
rJMSF042G07+ GTATTTGGAAGAAAA
                      ____________________________________________________________
consensus TTTGGTATTCTATACGGAATAACTTGTAAGTAATCATAATGTGCAGTATTTGGAAGAAAA
 
. : . : . : . : . : . :
JMSF042G07- GTATCCACAGAATCCCTTGTTGCCGAAGGATCCTAAGTTAAAGGCTATTAATTTTCAGGC
rJMSF042G07+ GTATCCACAGAATCCCTTGTTGCCGAAGGATCCTAAGTTAAAGGCTATTAATTTTCAGGC
                      ____________________________________________________________
consensus GTATCCACAGAATCCCTTGTTGCCGAAGGATCCTAAGTTAAAGGCTATTAATTTTCAGGC
 
. : . : . : . : . : . :
JMSF042G07- TGCGAATATTGTTTCTGCAAACATACAGCCTCTACAAAATCTAGTTATTCTTAAATATAT
rJMSF042G07+ TGCGAATATTGTTTCTGCAAACATACAGCCTCTACAAAATCTAGTTATTCTTAAATATAT
                      ____________________________________________________________
consensus TGCGAATATTGTTTCTGCAAACATACAGCCTCTACAAAATCTAGTTATTCTTAAATATAT
 
. : . : . : . : . : . :
JMSF042G07- TGAAGACAAAGTTGGTCCTAATGAGAAAGTTCCATGGGGCCTGACTCATATAAAAAAAGG
rJMSF042G07+ TGAAGACAAAGTTGGTCCTAATGAGAAAGTTCCATGGGGCCTGACTCATATAAAAAAAGG
                      ____________________________________________________________
consensus TGAAGACAAAGTTGGTCCTAATGAGAAAGTTCCATGGGGCCTGACTCATATAAAAAAAGG
 
. : . : . : . : . : . :
JMSF042G07- CTTTGCTG
rJMSF042G07+ CTTTGCTGGTAAAAGCTTTGTTCCTATTGGCTTTCTTGAAATCCTGTTAAGTGTGACTGA
                      ____________________________________________________________
consensus CTTTGCTGGTAAAAGCTTTGTTCCTATTGGCTTTCTTGAAATCCTGTTAAGTGTGACTGA
 
. : . : . : . : . : . :
rJMSF042G07+ AGTGCTCCATTGCACTTGGTCTTTCATTTCTGATATTGGGTTTTTGTGATTTTACTCCTG
                      ____________________________________________________________
consensus AGTGCTCCATTGCACTTGGTCTTTCATTTCTGATATTGGGTTTTTGTGATTTTACTCCTG
 
. : . : . : . : . : . :
rJMSF042G07+ ATGCCAATTTTGCAGCATTGGAGAAGCTACTGAAAAGTTATGCTGGAAAGTATGCCACTG
                      ____________________________________________________________
consensus ATGCCAATTTTGCAGCATTGGAGAAGCTACTGAAAAGTTATGCTGGAAAGTATGCCACTG
 
. : . : . : . : . : . :
rJMSF042G07+ GTGATCAAATTTATCTGGCTGATCTATTTCTAGTGCCCCAAATCCATCGAGCAATCAACA
                      ____________________________________________________________
consensus GTGATCAAATTTATCTGGCTGATCTATTTCTAGTGCCCCAAATCCATCGAGCAATCAACA
 
. : . : . : . : . : . :
rJMSF042G07+ GTTTCAATTTGGATATGAATGAATATCCCCTTCTATCTCGTATATACGAGGTGTACAAAG
                      ____________________________________________________________
consensus GTTTCAATTTGGATATGAATGAATATCCCCTTCTATCTCGTATATACGAGGTGTACAAAG
 
. : . : . : . : . : . :
rJMSF042G07+ AGGTACCTGCTATTCAAAATGCTATGCCGGAGAAACAGCCTGATGCACCAGCTGAGGCAA
                      ____________________________________________________________
consensus AGGTACCTGCTATTCAAAATGCTATGCCGGAGAAACAGCCTGATGCACCAGCTGAGGCAA
 
. : . : . : . : . : . :
rJMSF042G07+ GAGCTTGAGGTGATTTATCAATGAAGGAAACTAAAGAGAGAATCTATTCTACAATGAAAA
                      ____________________________________________________________
consensus GAGCTTGAGGTGATTTATCAATGAAGGAAACTAAAGAGAGAATCTATTCTACAATGAAAA
 
. : . : . : . : . : . :
rJMSF042G07+ CTGGAGTGGAAGCCCTTTTTTCTTATTCTCAATTTCTGTATACAACACTAACACAACACA
                      ____________________________________________________________
consensus CTGGAGTGGAAGCCCTTTTTTCTTATTCTCAATTTCTGTATACAACACTAACACAACACA