Previous Contig 013408:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015A20Sequence230007489 (9)gb:AY062680_15653360.031Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.751013408 (3)gb:AY062680_1565336e-100Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMSF025H12Sequence690007489 (9)gb:AY062680_15653363e-33Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.773013408 (3)gb:AY062680_1565336e-103Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.
JMSF042F16Sequence766007489 (9)gb:AY062680_15653362e-41Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.512013408 (3)gb:AY062680_15653361e-51Arabidopsis thaliana Unknown protein (At1g09970; F21M12.36) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF025H12+ CTC
                      ____________________________________________________________
consensus CTC
 
. : . : . : . : . : . :
rJMSF015A20+ TCGAAAGAGTTCGACGCGGAAGTCCAAA-CNNTGAGCTCAAT
rJMSF025H12+ CGGGAACGTGCGGCGAAATCGAAAGAGTTCGACGCGGAAGTCCAAACCATTGAGCTCAAT
                      ____________________________________________________________
consensus CGGGAACGTGCGGCGAAATCGAAAGAGTTCGACGCGGAAGTCCAAACCATTGAGCTCAAT
 
. : . : . : . : . : . :
rJMSF015A20+ ACGGCATGTTAACGTTGTTAAACTGTATTGCAGCATTACCAGCGAGGATTCAAGTCTGTT
rJMSF025H12+ ACGGCATGTTAACGTTGTTAAACTGTATTGCAGCATTACCAGCGAGGATTCAAGTCTGTT
                      ____________________________________________________________
consensus ACGGCATGTTAACGTTGTTAAACTGTATTGCAGCATTACCAGCGAGGATTCAAGTCTGTT
 
. : . : . : . : . : . :
rJMSF015A20+ GGTCTATGAATACTTGCCCAATGGAAGCTTATGGGATCGACTGCACACCTGCAAGAAAAT
rJMSF025H12+ GGTCTATGAATACTTGCCCAATGGAAGCTTATGGGATCGACTGCACACCTGCAAGAAAAT
                      ____________________________________________________________
consensus GGTCTATGAATACTTGCCCAATGGAAGCTTATGGGATCGACTGCACACCTGCAAGAAAAT
 
. : . : . : . : . : . :
rJMSF015A20+ GGCGTTGGATTGGGAGACGAGGTATGATATCGCCGTCGGAGCCGCCAAGGGGTTGGAGTA
rJMSF025H12+ GGCGTTGGATTGGGAGACGAGGTATGATATCGCCGTCGGAGCCGCCAAGGGGTTGGAGTA
                      ____________________________________________________________
consensus GGCGTTGGATTGGGAGACGAGGTATGATATCGCCGTCGGAGCCGCCAAGGGGTTGGAGTA
 
. : . : . : . : . : . :
rJMSF015A20+ TCTCCACCACGGCTGTGACCGCCCGGTGATTCACCGGGATATCAAGTCGAGTAACATTTT
rJMSF025H12+ TCTCCACCACGGCTGTGACCGCCCGGTGATTCACCGGGATATCAAGTCGAGTAACATTTT
rJMSF042F16+ GATTCACCGGGATATCAAGTCGAGTAACATTTT
                      ____________________________________________________________
consensus TCTCCACCACGGCTGTGACCGCCCGGTGATTCACCGGGATATCAAGTCGAGTAACATTTT
 
. : . : . : . : . : . :
rJMSF015A20+ ATTAGACGAGTTCTTGAAATCAAGAATCGCAGATTTTGGCCTTGCAAAGCTAGTTCAGCC
rJMSF025H12+ ATTAGACGAGTTCTTGAAATCAAGAATCGCAGATTTTGGCCTTGCAAAGCTAGTTCAGCC
rJMSF042F16+ ATTAGACGAGTTCTTGAAATCANGAATCGCAGATTTTGGCC-TGCAAAGNTAGTTCAGCC
                      ____________________________________________________________
consensus ATTAGACGAGTTCTTGAAATCAAGAATCGCAGATTTTGGCCTTGCAAAGCTAGTTCAGCC
 
. : . : . : . : . : . :
rJMSF015A20+ TGATGCCATTCACGATTCAACTCATGTCATTGCTGGAACTCATGGATACATTGCTCCAGA
rJMSF025H12+ TGATGCCATTCACGATTCAACTCATGTCATTGCTGGAACTCATGGATACATTGCTCCAGA
rJMSF042F16+ TGATGCCATTCACGATTCAACTCATGTCATTGCTGGAACTCATGGATACATTGCTCCAGA
                      ____________________________________________________________
consensus TGATGCCATTCACGATTCAACTCATGTCATTGCTGGAACTCATGGATACATTGCTCCAGA
 
. : . : . : . : . : . :
rJMSF015A20+ GTATGGGTACACGAACAAAGTAAATGAGAAGAGCGGCGTGTACAGTTTCGGAGTGGTGCT
rJMSF025H12+ GTATGGGTACACGAACAAAGTAAATGAGAAGAGCGACGTGTACAGTTTCGGAGTGGTGCT
rJMSF042F16+ GTATGGGTACACGAACAAAGTAAATGAGAAGAGCGACGTGTACAGTTTCGGAGTGGTGCT
                      ____________________________________________________________
consensus GTATGGGTACACGAACAAAGTAAATGAGAAGAGCGACGTGTACAGTTTCGGAGTGGTGCT
 
. : . : . : . : . : . :
rJMSF015A20+ GATGGAACTCGTGTTGGGGAAAAGGCCAACGGAGGCGGAATATGGAGAAAACAACGACAT
rJMSF025H12+ GATGGAACTCGTGTTGGGGAAAAGGCCAACGGAGGCGGAATATGGAGAAAACAACGACAT
rJMSF042F16+ GATGGAACTCGTGTTGGGGAAAAGGCCAACGGAGGCGGAATATGGAGAAAACAACGACAT
                      ____________________________________________________________
consensus GATGGAACTCGTGTTGGGGAAAAGGCCAACGGAGGCGGAATATGGAGAAAACAACGACAT
 
. : . : . : . : . : . :
rJMSF015A20+ TGTGAGCTGGGTTAGCAGCAAATTGTGTAGCAAAGAGAGTGTGTTAAACCTAGTTGATTC
rJMSF025H12+ TGTGAGCTGGGTTAGCAGCAAATTGTGTAGCAAAGAGAGTGTGTTAAACCTAGTTGATTC
rJMSF042F16+ TGTGAGCTGGGTTAGCAGCAAATTGTGTAGCAAAGAGAGTGTGTTAAACCTAGTTGATTC
                      ____________________________________________________________
consensus TGTGAGCTGGGTTAGCAGCAAATTGTGTAGCAAAGAGAGTGTGTTAAACCTAGTTGATTC
 
. : . : . : . : . : . :
rJMSF015A20+ AGAAATCCGACAATCTTACAAAGAAGATGCCATTAAGGTGTTAAGGATTGCAGTCATGTG
rJMSF025H12+ AGAAATCCGACAATCTTACAAAGAAGATGCCATTAAGGTGTTAAGGATTGCAGTCATGTG
rJMSF042F16+ AGAAATCCGACAATCTTACAAAGAAGATGCCATTAAGGTGTTAAGGATTGCAGTCATGTG
                      ____________________________________________________________
consensus AGAAATCCGACAATCTTACAAAGAAGATGCCATTAAGGTGTTAAGGATTGCAGTCATGTG
 
. : . : . : . : . : . :
rJMSF015A20+ CACGGCCAGGCTCCCAAGTTTAAGGCCTTCAATGAGGATCTGTGGTCAAAATGCTGGAGG
rJMSF025H12+ CACGGCCAGGCTCCCAAGTTTAAGGCCTTCAATGAGGA-CTGTGGTCAAAATGCTGGAGG
rJMSF042F16+ CACGGCCAGGCTCCCAAGTTTAAGGCCTTCAATGAGGANCTGTGGTCAAAATGCTGGAGG
                      ____________________________________________________________
consensus CACGGCCAGGCTCCCAAGTTTAAGGCCTTCAATGAGGATCTGTGGTCAAAATGCTGGAGG
 
. : . : . : . : . : . :
rJMSF015A20+ ATGCGCAGCCGTGCAATTTGTTGGGAGTAGTTGTTTGTAAAC
rJMSF025H12+ ATGCGCAGCCGTGCAATTTGTTGGGAGTAGTTGTTTGTAAAC
rJMSF042F16+ ATGCGCAGCCGTGCAATTTGTTGGGAGTAGTTGTTTGTAAAACAAGAGTGTTAATAATTA
                      ____________________________________________________________
consensus ATGCGCAGCCGTGCAATTTGTTGGGAGTAGTTGTTTGTAAACCAAGAGTGTTAATAATTA