Previous Contig 013406:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS115H11Sequence641013406 (2)gb:AY091003_15742356e-60Arabidopsis thaliana unknown protein (At3g05675) mRNA, complete cds.
JMSF042F08Sequence659020136gb:AY091003_15742351e-43Arabidopsis thaliana unknown protein (At3g05675) mRNA, complete cds.840013406 (2)gb:AY091003_15742355e-58Arabidopsis thaliana unknown protein (At3g05675) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS115H11- TCGAGTAC
                      ____________________________________________________________
consensus TCGAGTAC
 
. : . : . : . : . : . :
JMFS115H11- ATGGTTGTTGAAGATGATGATGCTCCTCTGTTAACGGCCGATAATGAGATAAAACTAGAG
                      ____________________________________________________________
consensus ATGGTTGTTGAAGATGATGATGCTCCTCTGTTAACGGCCGATAATGAGATAAAACTAGAG
 
. : . : . : . : . : . :
JMFS115H11- GTAGTGCAATGCATTAAGAGACTGCTCGATAGGTTTAGCCAACTCGTAGAGTCTTTACTG
rJMSF042F08+ GTAGTGCNATGCATTAAGAGACTGCTCGATAGGTTTAGCCAACTNGTAGAGTCTTTACTG
                      ____________________________________________________________
consensus GTAGTGCAATGCATTAAGAGACTGCTCGATAGGTTTAGCCAACTCGTAGAGTCTTTACTG
 
. : . : . : . : . : . :
JMFS115H11- TGCGATGTCCAAGAATCGATATCCGAGGACGGGAAATTGCAGTTATTTAAGTCGTGTTTA
rJMSF042F08+ TGCGATGTCCAAGAATCGATATCCGAGGACGGGAAATTGCAGTTATTTAAGTCGTGTTTA
                      ____________________________________________________________
consensus TGCGATGTCCAAGAATCGATATCCGAGGACGGGAAATTGCAGTTATTTAAGTCGTGTTTA
 
. : . : . : . : . : . :
JMFS115H11- TCGGATTTATCCTGGGCTTGCCAGATATTAACGAAATTGGAGATTATGAGAGATTTTGTT
rJMSF042F08+ TCGGATTTATCCTGGGCTTGCCAGATATTAACGAAATTGGAGATTATGAGAGATTTTGTT
                      ____________________________________________________________
consensus TCGGATTTATCCTGGGCTTGCCAGATATTAACGAAATTGGAGATTATGAGAGATTTTGTT
 
. : . : . : . : . : . :
JMFS115H11- CACAGATGGACAGAGATATCAGTTAAAATAATAAAGGTTGTTCAGCAGTTGAGCCCCGAA
rJMSF042F08+ CACAGATGGACAGAGATATCAGTTAAAATAATAAAGGTTGTTCAGCAGTTGAGCCCCGAA
                      ____________________________________________________________
consensus CACAGATGGACAGAGATATCAGTTAAAATAATAAAGGTTGTTCAGCAGTTGAGCCCCGAA
 
. : . : . : . : . : . :
JMFS115H11- GCTGAAACAATCGGGACCAAATTGAAGGTTCTTGAGGTGGCGGCAAAAGTCCTAGAGGCA
rJMSF042F08+ GCTGAAACAATCGGGACCAAATTGAAGGTTCTTGAGGTGGCGGCAAAAGTCCTAGAGGCA
                      ____________________________________________________________
consensus GCTGAAACAATCGGGACCAAATTGAAGGTTCTTGAGGTGGCGGCAAAAGTCCTAGAGGCA
 
. : . : . : . : . : . :
JMFS115H11- ATAGGATATGGCACGGTTATTCTGCCCGCGACGAAGCGCCTCCACATGGCAAAGGTCTGG
rJMSF042F08+ ATAGGATATGGCACGGTTATTCTGCCCGCGACGAAGCGCCTCCACATGGCAAAGGTCTGG
                      ____________________________________________________________
consensus ATAGGATATGGCACGGTTATTCTGCCCGCGACGAAGCGCCTCCACATGGCAAAGGTCTGG
 
. : . : . : . : . : . :
JMFS115H11- CTTCCGTTTGTCCGGGCAATTAAGCCTTTGAGTGATTCGGTGACTGCCGACAGTGACGAT
rJMSF042F08+ CTTCCGTTTGTCCGGGCAATTAAGCCTTTGAGTGATTCGGTGACTGCCGACAGTGACGAT
                      ____________________________________________________________
consensus CTTCCGTTTGTCCGGGCAATTAAGCCTTTGAGTGATTCGGTGACTGCCGACAGTGACGAT
 
. : . : . : . : . : . :
JMFS115H11- GATCTGATTCCGAAAATAGACGGTGATCTATGGCAATCCTTAGAGGCGTCGTTTGTTTCA
rJMSF042F08+ GATCTGATTCCGAAAATAGACGGTGATCTATGGCAATCCTTAGAGGCGTCGTTTGTTTCA
                      ____________________________________________________________
consensus GATCTGATTCCGAAAATAGACGGTGATCTATGGCAATCCTTAGAGGCGTCGTTTGTTTCA
 
. : . : . : . : . : . :
JMFS115H11- ATGATACTTACATTGCCCTCGGCAGATCAGGCGGAGATCTTGACGGAGTGGTGGACAAAC
rJMSF042F08+ ATGATACTTACATTGCCCTCGGCAGATCAGGCGGAGATCTTGACGGAGTGGTGGACAAAC
                      ____________________________________________________________
consensus ATGATACTTACATTGCCCTCGGCAGATCAGGCGGAGATCTTGACGGAGTGGTGGACAAAC
 
. : . : . : . : . : . :
JMFS115H11- CAGCATGTCCAGTATCCAGACCTCACCGAGGCC
rJMSF042F08+ CAGCATGTCCAGTATCCAGACCTCACCGAGGCCTTTGAAGCGTGGTGTTATAGATCCAAG
                      ____________________________________________________________
consensus CAGCATGTCCAGTATCCAGACCTCACCGAGGCCTTTGAAGCGTGGTGTTATAGATCCAAG
 
. : . : . : . : . : . :
rJMSF042F08+ GCTGCCAAGCGAAGGCTGGCAATGCTCGAAGGAGATCATAGCACCGCCAATCCAGTATGA
                      ____________________________________________________________
consensus GCTGCCAAGCGAAGGCTGGCAATGCTCGAAGGAGATCATAGCACCGCCAATCCAGTATGA
 
. : . : . : . : . : . :
rJMSF042F08+ TCACTTCTTCCGACAGATTAGAACACCGTTTTGTCAATCTAATCGTTAGGAACTGGAAAT
                      ____________________________________________________________
consensus TCACTTCTTCCGACAGATTAGAACACCGTTTTGTCAATCTAATCGTTAGGAACTGGAAAT
 
. : . : . : . : . : . :
rJMSF042F08+ TTTTTTCTTCTGTTCTCGACATGGCTAAAATGGTCTCGGTTTTGTAAATTCATACCCGTA
                      ____________________________________________________________
consensus TTTTTTCTTCTGTTCTCGACATGGCTAAAATGGTCTCGGTTTTGTAAATTCATACCCGTA
 
. : . : . : . : . : . :
rJMSF042F08+ CTTCTGGCACCCCATTCCGTTCGATTGTTTTAATCGTGGGGCCTTTTGTAAAACTCGAGT
                      ____________________________________________________________
consensus CTTCTGGCACCCCATTCCGTTCGATTGTTTTAATCGTGGGGCCTTTTGTAAAACTCGAGT