Previous Contig 013403:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF041E12Sequence125007405 (3)520013403 (3)pir|D86161|D861610.027F10O3.12 protein - Arabidopsis thaliana>gb:AE005172_889325 Arabidopsis thaliana
JMSF041G12Sequence125007405 (3)521013403 (3)pir|D86161|D861610.027F10O3.12 protein - Arabidopsis thaliana>gb:AE005172_889325 Arabidopsis thaliana
JMSF042E12Sequence125007405 (3)535013403 (3)pir|D86161|D861616e-06F10O3.12 protein - Arabidopsis thaliana>gb:AE005172_889325 Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041G12+ TNTNTCNAAAAAAAAAAAGAGCAAAAAAATAATCGAAGCTAGATCATCCGAATAAGAG
rJMSF041E12+ AAAAAAAAAAAGAGCAAAAAAATAATCGAAGCTAGATCATCCGAATAAGAG
rJMSF042E12+ AAAAAAAAAAAGAGCAAAAAAATAATCGAAGCTAGATCATCCGAATAAGAG
                      ____________________________________________________________
consensus TNTNTCNAAAAAAAAAAAGAGCAAAAAAATAATCGAAGCTAGATCATCCGAATAAGAG
 
. : . : . : . : . : . :
rJMSF041G12+ GAAAAATCGGATTAAAAAACTGATCAAAATATCCAGATCTTGCTGCTTTCAATCAATTTA
rJMSF041E12+ GAAAAATCGGATTAAAAAACTGATCAAAATATCCAGATCTTGCTGCTTTCAATCAATTTA
rJMSF042E12+ GAAAAATCGGATTAAAAAACTGATCAAAATATCCAGATCTTGCTGCTTTCAATCAATTTA
                      ____________________________________________________________
consensus GAAAAATCGGATTAAAAAACTGATCAAAATATCCAGATCTTGCTGCTTTCAATCAATTTA
 
. : . : . : . : . : . :
rJMSF041G12+ TTTATTTCTGCTTTTCTTCACATTTTATGTGAATTATATTGTTGGTAGATAGGTAGACAG
rJMSF041E12+ TTTATTTCTGCTTTTCTTCACATTTTATGTGAATTATATTGTTGGTAGATAGGTAGACAG
rJMSF042E12+ TTTATTTCTGCTTTTCTTCACATTTTATGTGAATTATATTGTTGGTAGATAGGTAGACAG
                      ____________________________________________________________
consensus TTTATTTCTGCTTTTCTTCACATTTTATGTGAATTATATTGTTGGTAGATAGGTAGACAG
 
. : . : . : . : . : . :
rJMSF041G12+ AGACATATAATCGTCTGGTTTTTTTATGTATTGAGCTGAGAGATCCTTCTAGAGCTCTGC
rJMSF041E12+ AGACATATAATCGTCTGGTTTTTTTATGTATTGAGCTGAGAGATCCTTCTAGAGCTCTGC
rJMSF042E12+ AGACATATAATCGTCTGGTTTTTTTATGTATTGAGCTGAGAGATCCTTCTAGAGCTCTGC
                      ____________________________________________________________
consensus AGACATATAATCGTCTGGTTTTTTTATGTATTGAGCTGAGAGATCCTTCTAGAGCTCTGC
 
. : . : . : . : . : . :
rJMSF041G12+ CTAGAAGGGATCGGATCTGCCTGGGATTGAACTAATCGGCGGTCGGGTTGTTCGTCGGAT
rJMSF041E12+ CTAGAAGGGATCGGATCTGCCTGGGATTGAACTAATCGGCGGTCGGGTTGTTCGTCGGAT
rJMSF042E12+ CTAGAAGGGATCGGATCTGCCTGGGATTGAACTAATCGGCGGTCGGGTTGTTCGTCGGAT
                      ____________________________________________________________
consensus CTAGAAGGGATCGGATCTGCCTGGGATTGAACTAATCGGCGGTCGGGTTGTTCGTCGGAT
 
. : . : . : . : . : . :
rJMSF041G12+ GAGAGACGGCGTTGAATGTTCGGGAAATCGGCCGGGAGAACGATGAAATGGGCATCATTG
rJMSF041E12+ GAGAGACGGCGTTGAATGTTCGGGAAATCGGCCGGGAGAACGATGAAATGGGCATCATTG
rJMSF042E12+ GAGAGACGGCGTTGAATGTTCGGGAAATCGGCCGGGAGAACGATGAAATGGGCATCATTG
                      ____________________________________________________________
consensus GAGAGACGGCGTTGAATGTTCGGGAAATCGGCCGGGAGAACGATGAAATGGGCATCATTG
 
. : . : . : . : . : . :
rJMSF041G12+ CTTAAAGACTTTAAGGAAAAGGTCGGCCTCGCTCAGCCTCCTTCCGCTGTCTCCTCACCT
rJMSF041E12+ CTTAAAGACTTTAAGGAAAAGGTCGGCCTCGCTCAGCCTCCTTCCGCTGTCTCCTCACCT
rJMSF042E12+ CTTAAAGACTTTAAGGAAAAGGTCGGCCTCGCTCAGCCTCCTTCCGCTGTCTCCTCACCT
                      ____________________________________________________________
consensus CTTAAAGACTTTAAGGAAAAGGTCGGCCTCGCTCAGCCTCCTTCCGCTGTCTCCTCACCT
 
. : . : . : . : . : . :
rJMSF041G12+ TCGGCTTCTGCTTCCTCGTCATTTCACGATAACTATGCCTTGCCTACCAACCTCAATCTC
rJMSF041E12+ TCGGCTTCTGCTTCCTCGTCATTTCACGATAACTATGCCTTGCCTACCAACCTCAATCTC
rJMSF042E12+ TCGGCTTCTGCTTCCTCGTCATTTCACGATAACTATGCCTTGCCTACCAACCTCAATCTC
                      ____________________________________________________________
consensus TCGGCTTCTGCTTCCTCGTCATTTCACGATAACTATGCCTTGCCTACCAACCTCAATCTC
 
. : . : . : . : . : . :
rJMSF041G12+ GACTTCAGCTTATCTCCTTCGAGAGACAAACCATGAATTGGAA
rJMSF041E12+ GACTTCAGCTTATCTCCTTCGAGAGACAAACCATGAATTGGAA
rJMSF042E12+ GACTTCAGCTTATCTCCTTCGAGAGACAAA-CATGAATTGGAATTGGACTCAAGAGATAT
                      ____________________________________________________________
consensus GACTTCAGCTTATCTCCTTCGAGAGACAAACCATGAATTGGAATTGGACTCAAGAGATAT