Previous Contig 013395:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027E04Sequence564003463 (3)gb:AF478370_18033561e-51Vitis vinifera isolate 4B11 copia-like retrotransposon gag-pol polyprotein gene,756013395 (5)gb:BT008621_16398324e-73Arabidopsis thaliana clone RAFL21-18-G06 (R51064) unknown protein (At1g75420) mR
JMFF044P03Sequence638003463 (3)gb:AF478370_18033562e-51Vitis vinifera isolate 4B11 copia-like retrotransposon gag-pol polyprotein gene,615013395 (5)gb:BT008621_16398322e-54Arabidopsis thaliana clone RAFL21-18-G06 (R51064) unknown protein (At1g75420) mR
JMSF033C03Sequence641007476 (3)gb:BT008621_16398328e-17Arabidopsis thaliana clone RAFL21-18-G06 (R51064) unknown protein (At1g75420) mR692013395 (5)gb:BT008621_16398323e-74Arabidopsis thaliana clone RAFL21-18-G06 (R51064) unknown protein (At1g75420) mR
JMSF042C14Sequence778007476 (3)gb:AP001366_18212135e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P046801013395 (5)gb:BT008621_16398326e-77Arabidopsis thaliana clone RAFL21-18-G06 (R51064) unknown protein (At1g75420) mR
JMSF048J14Sequence685007476 (3)gb:AP001366_18212135e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P046774013395 (5)gb:BT008621_16398321e-88Arabidopsis thaliana clone RAFL21-18-G06 (R51064) unknown protein (At1g75420) mR

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF048J14+ CATGAAATGCGAGGCCACTACTTCCATCTTGACTATGTAAAACATCTTCCACTTGTTG
                      ____________________________________________________________
consensus CATGAAATGCGAGGCCACTACTTCCATCTTGACTATGTAAAACATCTTCCACTTGTTG
 
. : . : . : . : . : . :
rJMSF048J14+ CTGGTGCAATGATTGATTCACATGTAACAGCAGAATACTGGAAGAATAGGACAGCAGAAC
                      ____________________________________________________________
consensus CTGGTGCAATGATTGATTCACATGTAACAGCAGAATACTGGAAGAATAGGACAGCAGAAC
 
. : . : . : . : . : . :
rJMSF048J14+ GCCTAAGGATTAAAATGCCCAAAACCTATGTTGTTCACCTTGGGAATAGCAAGGAGCTAA
                      ____________________________________________________________
consensus GCCTAAGGATTAAAATGCCCAAAACCTATGTTGTTCACCTTGGGAATAGCAAGGAGCTAA
 
. : . : . : . : . : . :
rJMSF048J14+ TGGAAGTTGCTGAAGATAGTGTTGCAAAAAGGATTTTGCGGGAACATGTTCGTGAGTCAC
rJMFF027E04+ C
rJMSF042C14+ GGGAACATGTTCGTGAGTCAC
                      ____________________________________________________________
consensus TGGAAGTTGCTGAAGATAGTGTTGCAAAAAGGATTTTGCGGGAACATGTTCGTGAGTCAC
 
. : . : . : . : . : . :
rJMSF048J14+ TTGGAGTTAG-AAATGAGGATATACTATTTGCTCTGATAAACAGTGTTTCTCGTGGGAAG
rJMFF027E04+ TTGGAGTTAG-AAATGAGGATATACTATTTGCTCTGATAAACAGTGTTTCTCGTGGGAAG
rJMSF033C03+ CTCTGATAAACAGTGTTTCTCGTGGGAAG
rJMSF042C14+ TTGGAGTTAGNAAATGAGGATATACTATTTGCTCTGATAAACAGTGTTTCTCGTGGGAAG
                      ____________________________________________________________
consensus TTGGAGTTAG-AAATGAGGATATACTATTTGCTCTGATAAACAGTGTTTCTCGTGGGAAG
 
. : . : . : . : . : . :
rJMSF048J14+ GGTCAAGACTTATTTTTGCATTCCTTCTATGAGAGCTTGCAATTGATTCAACAAAAGAAG
rJMFF027E04+ GGTCAAGACTTATTTTTGCATTCCTTCTATGAGAGCTTGCAATTGATTCAACAAAAGAAG
rJMSF033C03+ GGTCAAGACTTATTTTTGCATTCCTTCTATGAGAGCTTGCAATTGATTCAACAAAAGAAG
rJMSF042C14+ GGTCAAGACTTATTTTTGCATTCCTTCTATGAGAGCTTGCAATTGATTCAACAAAAGAAG
                      ____________________________________________________________
consensus GGTCAAGACTTATTTTTGCATTCCTTCTATGAGAGCTTGCAATTGATTCAACAAAAGAAG
 
. : . : . : . : . : . :
rJMSF048J14+ TTACAATTGCCAACTGTCCATGCTGTTGTTGTAGGAAGTGATTTGACTACTCAAAGCAAA
rJMFF027E04+ TTACAATTGCCAACTGTCCATGCTGTTGTTGTAGGAAGTGATTTGACTACTCAAAGCAAA
rJMSF033C03+ TTACAATTGCCAACTGTCCATGCTGTTGTTGTAGGAAGTGATTTGACTACTCAAAGCAAA
rJMFF044P03+ TAGGAAGTGATTTGACTACTCAAAGCAAA
rJMSF042C14+ TTACAATTGCCAACTGTCCATGCTGTTGTTGTAGGAAGTGATTTGACTACTCAAAGCAAA
                      ____________________________________________________________
consensus TTACAATTGCCAACTGTCCATGCTGTTGTTGTAGGAAGTGATTTGACTACTCAAAGCAAA
 
. : . : . : . : . : . :
rJMSF048J14+ TTTGAGTTAGAGCTTAGGAACTTTGTGCAACTTAAGAAGATCCAAAACTATGTGCATTTT
rJMFF027E04+ TTTGAGTTAGAGCTTAGGAACTTTGTGCAACTTAAGAAGATCCAAAACTATGTGCATTTT
rJMSF033C03+ TTTGAGTTAGAGCTTAGGAACTTTGTGCAACTTAAGAAGATCCAAAACTATGTGCATTTT
rJMFF044P03+ TTTGAGTTAGAGCTTAGGAACTTTGTGCAACTTAAGAAGATCCAAAACTATGTGCATTTT
rJMSF042C14+ TTTGAGTTAGAGCTTAGGAACTTTGTGCAACTTAAGAAGATCCAAAACTATGTGCATTTT
                      ____________________________________________________________
consensus TTTGAGTTAGAGCTTAGGAACTTTGTGCAACTTAAGAAGATCCAAAACTATGTGCATTTT
 
. : . : . : . : . : . :
rJMSF048J14+ GTCAATAAGACTCTGACAGTTGCACCATATCTTGCTGCAATTGATGTACTTGTGCAAAAT
rJMFF027E04+ GTCAATAAGACTCTGACAGTTGCACCATATCTTGCTGCAATTGATGTACTTGTGCAAAAT
rJMSF033C03+ GTCAATAAGACTCTGACAGTTGCACCATATCTTGCTGCAATTGATGTACTTGTGCAAAAT
rJMFF044P03+ GTCAATAAGACTCTGACAGTTGCACCATATCTTGCTGCAATTGATGTACTTGTGCAAAAT
rJMSF042C14+ GTCAATAAGACTCTGACAGTTGCACCATATCTTGCTGCAATTGGTGTACTTGTGCAAAAT
                      ____________________________________________________________
consensus GTCAATAAGACTCTGACAGTTGCACCATATCTTGCTGCAATTGATGTACTTGTGCAAAAT
 
. : . : . : . : . : . :
rJMSF048J14+ TCACAGGCCCGGGGAGAATGTTTTGGTAGGATTACCATTGAAGCCATGGCATTTCAGCTT
rJMFF027E04+ TCACAGGCCCGGGGAGAATGTTTTGGTAGGATTACCATTGAAGCCATGGCATTTCAGCTT
rJMSF033C03+ TCACAGGCCCGGGGAGAATGTTTTGGTAGGATTACCATTGAAGCCATGGCATTTCAGCTT
rJMFF044P03+ TCACAGGCCCGGGGAGAATGTTTTGGTAGGATTACCATTGAAGCCATGGCATTTCAGCTT
rJMSF042C14+ TCACAGGCCCGGGGAGAATGTTTTGGTAGGATTACCATTGAAGCCATGGCATTTCAGCTT
                      ____________________________________________________________
consensus TCACAGGCCCGGGGAGAATGTTTTGGTAGGATTACCATTGAAGCCATGGCATTTCAGCTT
 
. : . : . : . : . : . :
rJMSF048J14+ CCTGTGTTG
rJMFF027E04+ CCTGTGTT-------GCAGCTGGTGGTACTCGAGAAGTCGTTCTAAACGGAACAACTGGG
rJMSF033C03+ CCTGTGTTGGGAACAGCAGCTGGTGGTACTCGAGAAATCGTTCTAAACGGAACAACTGGG
rJMFF044P03+ CCTGTGTT-------GCAGCTGGTGGTACTCGAGAAGTCGTTCTAAACGGAACAACTGGG
rJMSF042C14+ CCTGTGTTGGGAACAGCAGCTGGTGGTACTCGAGAAATCGTTCTAAACGGAACAACTGGG
                      ____________________________________________________________
consensus CCTGTGTTGGGAACAGCAGCTGGTGGTACTCGAGAAGTCGTTCTAAACGGAACAACTGGG
 
. : . : . : . : . : . :
rJMFF027E04+ TTACTGCACCCCGTGGGGAAAGGCGGGGTAATGCCTCTGGCAAGAAACATAGTGAACCTC
rJMSF033C03+ TTACTGCACCCCGTGGGGAAAGGCGGGGTAATGCCTCTGGCAAGAAACATAGTGAACCTC
rJMFF044P03+ TTACTGCACCCCGTGGGGAAAGGCGGGGTAATGCCTCTGGCAAGAAACATAGTGAACCTC
rJMSF042C14+ TTACTGCACCCCGTGGGGAAAGGCGGGGTAATGCCTCTGGCAAGAAACATAGTGAACCTC
                      ____________________________________________________________
consensus TTACTGCACCCCGTGGGGAAAGGCGGGGTAATGCCTCTGGCAAGAAACATAGTGAACCTC
 
. : . : . : . : . : . :
rJMFF027E04+ GCCTCTCATGTCGAAAGGAGGCTTACGATGGGAAAGAAGGGTTACGGGAGGGTGAAAGAA
rJMSF033C03+ GCCTCTCATGTCGAAAGGAGGCTTACGATGGGAAAGAAGGGTTACGGGAGGGTGAAAGAA
rJMFF044P03+ GCCTCTCATGTCGAAAGGAGGCTTACGATGGGAAAGAAGGGTTACGGGAGGGTGAAAGAA
rJMSF042C14+ GCCTCTCATGTCGAAAGGAGGCTTACGATGGGAAAGAAGGGTTACGGGAGGGTGAAAGAA
                      ____________________________________________________________
consensus GCCTCTCATGTCGAAAGGAGGCTTACGATGGGAAAGAAGGGTTACGGGAGGGTGAAAGAA
 
. : . : . : . : . : . :
rJMFF027E04+ GTATTTTTGGAGCAGCATATGGAAGAACGGATTGGTGGCGTTTTGCAGGATGTGCTGCAA
rJMSF033C03+ GTATTTTTGGAGCAGCATATGGAAGAACGGATTGGTGGCGTTTTGCAGGATGTGCTGCAA
rJMFF044P03+ GTATTTTTGGAGCAGCATATGGAAGAACGGATTGGTGGCGTTTTGCAGGATGTGCTGCAA
rJMSF042C14+ GTATTTTTGGAGCAGCATATGGAAGAACGGATTGGTGGCGTTTTGCAGGATGTGCTGCAA
                      ____________________________________________________________
consensus GTATTTTTGGAGCAGCATATGGAAGAACGGATTGGTGGCGTTTTGCAGGATGTGCTGCAA
 
. : . : . : . : . : . :
rJMFF027E04+ AGGGCGAAGAGTGCTAAGAACAAAAGATCATAGACTGTATTGTATGTAGTAGTTCCAGGC
rJMSF033C03+ AGGGCGAAGAGTGCTAAGAACAAAAGATCATAGACTGTATTGTATGTAGTAGTTCCAGGC
rJMFF044P03+ AGGGCGAAGAGTGCTAAGAACAAAAGATCATAGACTGTATTGTATGTAGTAGTTCCAGGC
rJMSF042C14+ AGGGCGAAGAGTGCTAAGAACAAAAGATCATAGACTGTATTGTATGTAGTAGTTCCAGGC
                      ____________________________________________________________
consensus AGGGCGAAGAGTGCTAAGAACAAAAGATCATAGACTGTATTGTATGTAGTAGTTCCAGGC
 
. : . : . : . : . : . :
rJMFF027E04+ TTTCATTTCTTTCTTGGCTGGCAATCAATATTTAATGTTTGCTTGTTTGTACAAACTGTT
rJMSF033C03+ TTTCATTTCTTTCTTGGCTGGCAATCAATATTTAATGTTTGCTTGTTTGTACAAACTGTT
rJMFF044P03+ TTTCATTTCTTTCTTGGCTGGCAATCAATATTTAATGTTTGCTTGTTTGTACAAACTGTT
rJMSF042C14+ TTTCATTTCTTTCTTGGCTGGCAATCAATATTTAATGTTTGCTTGTTTGTACAAACTGTT
                      ____________________________________________________________
consensus TTTCATTTCTTTCTTGGCTGGCAATCAATATTTAATGTTTGCTTGTTTGTACAAACTGTT
 
. : . : . : . : . : . :
rJMFF027E04+ GCTGGCTGGGCGATTCGGGAAAACCAATTCTATACACAACAAA
rJMSF033C03+ GCT
rJMFF044P03+ GCTGGCTGGGCGATTCGGGAAAACCAATTCTATACACAACAAATTTGAGTT
rJMSF042C14+ GCTGGCTGGGCGATTCGGGAAAACCAATTCTATACACAACAAATTTGAGTTTCAAATAGA
                      ____________________________________________________________
consensus GCTGGCTGGGCGATTCGGGAAAACCAATTCTATACACAACAAATTTGAGTTTCAAATAGA