Previous Contig 013379:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019K23Sequence792013379 (2)pir|F84611|F846111e-11hypothetical protein At2g22350 [imported] - Arabidopsis thaliana>gb:AC006592_153
JMSF041N21Sequence468007450 (2)608013379 (2)gb:AP002032_18214927e-09Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MPH15.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019K23+ GATCGATGAAGGAATTTCTTCGACAGCAAAGAACAGAAG
                      ____________________________________________________________
consensus GATCGATGAAGGAATTTCTTCGACAGCAAAGAACAGAAG
 
. : . : . : . : . : . :
rJMSF019K23+ ACCATGTAGCGATAACATAATCTTTGCCGTCGCTGCATGGTGTATTTGGAAATGGCGTAA
                      ____________________________________________________________
consensus ACCATGTAGCGATAACATAATCTTTGCCGTCGCTGCATGGTGTATTTGGAAATGGCGTAA
 
. : . : . : . : . : . :
rJMSF019K23+ TGAAGCTTTNTTCAACGGAACTATCAAAGAGCTTAACTCAAAAATCCTTTCCATTAGATC
                      ____________________________________________________________
consensus TGAAGCTTTNTTCAACGGAACTATCAAAGAGCTTAACTCAAAAATCCTTTCCATTAGATC
 
. : . : . : . : . : . :
rJMSF019K23+ CCAAGCAGAGGACATCAGTAGAGCCTTTGCTAGAGAAAGAGGTCCCCATTCAATTGAAAG
rJMSF041N21+ ATTGAAAG
                      ____________________________________________________________
consensus CCAAGCAGAGGACATCAGTAGAGCCTTTGCTAGAGAAAGAGGTCCCCATTCAATTGAAAG
 
. : . : . : . : . : . :
rJMSF019K23+ GATATGATCTGGAAGCAACTATGCTGGGAAAAGCCGAGGGAAGGAATTGTTAAACTAAAC
rJMSF041N21+ GATATGATCTGGAAGCAACTATGCTGGGAAAAGCCGAGGGAAGGAATTGTTAAACTAAAC
                      ____________________________________________________________
consensus GATATGATCTGGAAGCAACTATGCTGGGAAAAGCCGAGGGAAGGAATTGTTAAACTAAAC
 
. : . : . : . : . : . :
rJMSF019K23+ GTAGATGGATCCGTGTCCTCAAGCTCTCAATCAGCCGGCTGTGGTGGAGCTATTAGAGAC
rJMSF041N21+ GTAGATGGATCCGTGTCCTCAAGCTCTCAATCAGCCGGCTGTGGTGGAGCTATTAGAGAC
                      ____________________________________________________________
consensus GTAGATGGATCCGTGTCCTCAAGCTCTCAATCAGCCGGCTGTGGTGGAGCTATTAGAGAC
 
. : . : . : . : . : . :
rJMSF019K23+ CATAATGGGAGGTGGAAGAGAGGCTTCCTTGCATCTTTTAAGTCCTGTACTCCATTTGAA
rJMSF041N21+ CATAATGGGAGGTGGAAGAGAGGCTTCCTTGCATCTTTTAAGTCCTGTACTCCATTTGAA
                      ____________________________________________________________
consensus CATAATGGGAGGTGGAAGAGAGGCTTCCTTGCATCTTTTAAGTCCTGTACTCCATTTGAA
 
. : . : . : . : . : . :
rJMSF019K23+ TCAGAAGCTTGGGCAATCCTCAAAGGTATCCAACTACTAGCGTCTATGAAGTATTCCCAT
rJMSF041N21+ TCAGAAGCTTGGGCAATCCTCAAAGGTATCCAACTACTAGCGTCTATGAAGTATTCCCAT
                      ____________________________________________________________
consensus TCAGAAGCTTGGGCAATCCTCAAAGGTATCCAACTACTAGCGTCTATGAAGTATTCCCAT
 
. : . : . : . : . : . :
rJMSF019K23+ GCTATTATAGAAAGTGATTCTGCAGAGGCGGTGGAGTACATTAACTCTACCAGGATACCA
rJMSF041N21+ GCTATTATAGAAAGTGATTCTGCAGAGGCGGTGGAGTACATTAACTCTACCAGGATACCA
                      ____________________________________________________________
consensus GCTATTATAGAAAGTGATTCTGCAGAGGCGGTGGAGTACATTAACTCTACCAGGATACCA
 
. : . : . : . : . : . :
rJMSF019K23+ TCAATTGCTGGCCACAACATCCTAGAGGCCTGCAAACGTGAGGTTCGCTCCTTTGAATTC
rJMSF041N21+ TCAATTGCTGGCCACAACATCCTAGAGGCCTGCAAACGTGAGGTTCGCTCCTTTGAATTC
                      ____________________________________________________________
consensus TCAATTGCTGGCCACAACATCCTAGAGGCCTGCAAACGTGAGGTTCGCTCCTTTGAATTC
 
. : . : . : . : . : . :
rJMSF019K23+ TGCCAGTTCAAGTTTATCCCTCGTGAAATCAACTGCGTGGCAGATTGTCTAGCTCGTCTG
rJMSF041N21+ TGCCAGTTCAAGTTTATCCCTCGTGAAATCAACTGCGTGGCAGATTGTCTAGCTCGTCTG
                      ____________________________________________________________
consensus TGCCAGTTCAAGTTTATCCCTCGTGAAATCAACTGCGTGGCAGATTGTCTAGCTCGTCTG
 
. : . : . : . : . : . :
rJMSF019K23+ GCAAGATTACAAGCTGCAAGTTTCCAGACTTTACTTGACCCTCCAGCAGAAACTAGATCT
rJMSF041N21+ GCAAGATTACAAGCTGCAAGTTTCCAGACTTTACTTGACCCTCCAGCAGAAACTAGATCT
                      ____________________________________________________________
consensus GCAAGATTACAAGCTGCAAGTTTCCAGACTTTACTTGACCCTCCAGCAGAAACTAGATCT
 
. : . : . : . : . : . :
rJMSF019K23+ CTTTTAGATGAGGACGCTGCTGGCTTTCCGGTTTGGCGTAACATGTGTAGTTCCCCTTAG
rJMSF041N21+ CTTTTAGATGAGGACGCTGCTGGCTTTCCGGTTTGGCGTAACATGTGTAGTTCCCCTTAG
                      ____________________________________________________________
consensus CTTTTAGATGAGGACGCTGCTGGCTTTCCGGTTTGGCGTAACATGTGTAGTTCCCCTTAG
 
. : . : . : . : . : . :
rJMSF019K23+ TTTTTGTACTGCTCCCTTTGTGGGTATCCCCCT
rJMSF041N21+ TTTTTGTACTGCTCCCTTTGTGGGTATCCCCCTTCCTCCTTATATATANTATAACCGTGA
                      ____________________________________________________________
consensus TTTTTGTACTGCTCCCTTTGTGGGTATCCCCCTTCCTCCTTATATATANTATAACCGTGA