Previous Contig 013375:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032L06Sequence568007447 (4)gb:AP002071_18219551e-57Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P067741013375 (4)gb:AP005260_18497635e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P055
JMFF034B13Sequence610013375 (4)
JMSF025B20Sequence617007447 (4)gb:AP002071_18219553e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P067784013375 (4)gb:AP005260_18497636e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P055
JMSF041N04Sequence780007447 (4)gb:AY054519_15631733e-93Arabidopsis thaliana Unknown protein (At1g07360; F22G5.30) mRNA, complete cds.>g609013375 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF032L06+ GGGGAAGNCCACAGGCNNCAAAGCNN
                      ____________________________________________________________
consensus GGGGAAGNCCACAGGCNNCAAAGCNN
 
. : . : . : . : . : . :
rJMFF032L06+ GAGTTNGAGATCNNTGATGAAGCAAGACAGCAGGNTNNTGTGGNTCATAGTGGTTTGTTG
rJMSF025B20+ TGATGAAGCAAGACAGCAGGCTACTGTGGCTCATAGTGGTTTGTTG
                      ____________________________________________________________
consensus GAGTTNGAGATCNNTGATGAAGCAAGACAGCAGGCTACTGTGGCTCATAGTGGTTTGTTG
 
. : . : . : . : . : . :
rJMFF034B13+ CTCCNTGGTGGTAGCCAG
rJMFF032L06+ CCAAGGGNTGTGATATCACAGCAGCAGAACCAGCCTNTCCCGCTCCNTGGTGGTAGCCAG
rJMSF025B20+ CCAAGGGCTGTGATATCACAGCAGCAGAACCAGCCTCTCCCGCTCCCTGGTGGTAGCCAG
                      ____________________________________________________________
consensus CCAAGGGCTGTGATATCACAGCAGCAGAACCAGCCTCTCCCGCTCCCTGGTGGTAGCCAG
 
. : . : . : . : . : . :
rJMFF034B13+ GACCAACCTCCACCACNTATGCCTTACTTCAACATTCCACCAATGCCTCAGCCGGACAGG
rJMFF032L06+ GACCAACCTCCACCACCTATGCCTTACTTCAACATTCCACCAATGCCTCAGCCGGACAGG
rJMSF025B20+ GACCAACCTCCACCACCTATGCCTTACTTCAACATTCCACCAATGCCTCAGCCGGACAGG
rJMSF041N04+ GG
                      ____________________________________________________________
consensus GACCAACCTCCACCACCTATGCCTTACTTCAACATTCCACCAATGCCTCAGCCGGACAGG
 
. : . : . : . : . : . :
rJMFF034B13+ GCATTGTATCCTTNTATGGATCCTCAAAGAATGGGAGCCGTTGTTCCATCACATGAAGGT
rJMFF032L06+ GCATTGTATCCTTNTATGGATCCTCAAAGAATGGGAGCCGTTGTTCCATCACATGAAGGT
rJMSF025B20+ GCATTGTATCCTTCTATGGATCCTCAAAGAATGGGAGCCGTTGTTCCATCACATGAAGGT
rJMSF041N04+ GCATTGTATCCTTCTATGGATCCTCAAAGAATGGGAGCCGTTGTTCCATCACATGAAGGT
                      ____________________________________________________________
consensus GCATTGTATCCTTCTATGGATCCTCAAAGAATGGGAGCCGTTGTTCCATCACATGAAGGT
 
. : . : . : . : . : . :
rJMFF034B13+ GCTGCTTCAGGGTCGGGCGAAAATAGAAGTGGTCCTGATAAGCAACCCCCACATGGACAC
rJMFF032L06+ GCTGCTTCAGGGTCGGGCGAAAATAGAAGTGGTCCTGATAAGCAACCCCCACATGGACAC
rJMSF025B20+ GCTGCTTCAGGGTCGGGCGAAAATAGAAGTGGTCCTGATAAGCAACCCCCACATGGACAC
rJMSF041N04+ GCTGCTTCAGGGTCGGGCGAAAATAGAAGTGGTCCTGATAAGCAACCCCCACATGGACAC
                      ____________________________________________________________
consensus GCTGCTTCAGGGTCGGGCGAAAATAGAAGTGGTCCTGATAAGCAACCCCCACATGGACAC
 
. : . : . : . : . : . :
rJMFF034B13+ CATTTTGCTTATCCGCCTGGGCCACCACCACCCCAGGGCCAATTTTACCCACCTTATTAT
rJMFF032L06+ CATTTTGCTTATCCGCCTGGGCCACCACCACCCCAGGGCCAATTTTACCCACCTTATTAT
rJMSF025B20+ CATTTTGCTTATCCGCCTGGGCCACCACCACCCCAGGGCCAATTTTACCCACCTTATTAT
rJMSF041N04+ CATTTTGCTTATCCGCCTGGGCCACCACCACCCCAGGGCCAATTTTACCCACCTTATTAT
                      ____________________________________________________________
consensus CATTTTGCTTATCCGCCTGGGCCACCACCACCCCAGGGCCAATTTTACCCACCTTATTAT
 
. : . : . : . : . : . :
rJMFF034B13+ CCACACTATGGGTATATCCCACCTCCCCCACCGTCTTATCAACAGTACCCTCCTCCACCT
rJMFF032L06+ CCACACTATGGGTATATCCCACCTCCCCCACCGTCTTATCAACAGTACCCTCCTCCACCT
rJMSF025B20+ CCACACTATGGGTATATCCCACCTCCCCCACCGTCTTATCAACAGTACCCTCCTCCACCT
rJMSF041N04+ CCACACTATGGGTATATCCCACCTCCCCCACCGTCTTATCAACAGTACCCTCCTCCACCT
                      ____________________________________________________________
consensus CCACACTATGGGTATATCCCACCTCCCCCACCGTCTTATCAACAGTACCCTCCTCCACCT
 
. : . : . : . : . : . :
rJMFF034B13+ TATCAGGCTACAGTGCCTCCACCACCTCCCGGCGGCAGCCAGGCACCACCTATGCAGCAG
rJMFF032L06+ TATCAGGCTACAGTGCCTCCACCACCTCCCGGCGGCAGCCAGGCACCACCTATGCAGCAG
rJMSF025B20+ TATCAGGCTACAGTGCCTCCACCACCTCCCGGCGGCAGCCAGGCACCACCTATGCAGCAG
rJMSF041N04+ TATCAGGCTACAGTGCCTCCACCACCTCCCGGCGGCAGCCAGGCACCACCTATGCAGCAG
                      ____________________________________________________________
consensus TATCAGGCTACAGTGCCTCCACCACCTCCCGGCGGCAGCCAGGCACCACCTATGCAGCAG
 
. : . : . : . : . : . :
rJMFF034B13+ TCACAGCCCGGAGCAGGCCAGCAAAGGCCAGTACCACAAGGACCAGGACAACAAGAACCG
rJMFF032L06+ TCACAGCCCGGAGCAGGCCAGCAAAGGCCAGTACCACAAGGACCAGGACAACAAGAACCG
rJMSF025B20+ TCACAGCCCGGAGCAGGCCAGCAAAGGCCAGTACCACAAGGACCAGGACAACAAGAACCG
rJMSF041N04+ TCACAGCCCGGAGCAGGCCAGCAAAGGCCAGTACCACAAGGACCAGGACAACAAGAACCG
                      ____________________________________________________________
consensus TCACAGCCCGGAGCAGGCCAGCAAAGGCCAGTACCACAAGGACCAGGACAACAAGAACCG
 
. : . : . : . : . : . :
rJMFF034B13+ GGACAACAGTCTTAATACCTGCACCCTTGTTACTGTTGGCTTAATTGCTGTTGTCAGAAA
rJMFF032L06+ GGACAACAGTCTTAATACCTGCACCCTTGTTACTGTTGGCTTAATTGCTGTTGTCAGAAA
rJMSF025B20+ GGACAACAGTCTTAATACCTGCACCCTTGTTACTGTTGGCTTAATTGCTGTTGTCAGAAA
rJMSF041N04+ GGACAACAGTCTTAATACCTGCACCCTTGTTACTGTTGGCTTAATTGCTGTTGTCAGAAA
                      ____________________________________________________________
consensus GGACAACAGTCTTAATACCTGCACCCTTGTTACTGTTGGCTTAATTGCTGTTGTCAGAAA
 
. : . : . : . : . : . :
rJMFF034B13+ ATAATTACTTTTTCTGGTCTAGTCTTTGCCTTAATTACTGTTGTCAGAAGATAATTACTT
rJMFF032L06+ ATAATTACTTTTTCTGGTCTAGTCTTTGCCTTAATTACTGTTGTCAGAAGATAATTACTT
rJMSF025B20+ ATAATTACTTTTTCTGGTCTAGTCTTTGCCTTAATTACTGTTGTCAGAAGATAATTACTT
rJMSF041N04+ ATAATTACTTTTTCTGGTCTAGTCTTTGCCTTAATTACTGTTGTCAGAAGATAATTACTT
                      ____________________________________________________________
consensus ATAATTACTTTTTCTGGTCTAGTCTTTGCCTTAATTACTGTTGTCAGAAGATAATTACTT
 
. : . : . : . : . : . :
rJMFF034B13+ TTCTGGTCTAGTCTTTGCCATTTAAACTCTAAGAAATTGACTTTGT
rJMFF032L06+ TTCTGGTCTAGTCTTTGCCATTTAAACTCTAAGAAATTGACTTTGT
rJMSF025B20+ TTCTGGTCTAGTCTTTGCCATTTAAACTCTAAGAAATTGACTTTGTTGAGCGACTTAAGA
rJMSF041N04+ TTCTGGTCTAGTCTTTGCCATTTAAACTCTAAGAAATTGACTTTGTTGAGCGACTTAAGA
                      ____________________________________________________________
consensus TTCTGGTCTAGTCTTTGCCATTTAAACTCTAAGAAATTGACTTTGTTGAGCGACTTAAGA
 
. : . : . : . : . : . :
rJMSF025B20+ TTTGTTTCTTACAATTTTACATGACCCCAGCGGTGATTATGTAATGAATATGTCTGAAA
rJMSF041N04+ TTTGTTTCTTACAATTTTACATGACCCCAGCGGTGATTATGTAATGAATATGTCTGAAAC
                      ____________________________________________________________
consensus TTTGTTTCTTACAATTTTACATGACCCCAGCGGTGATTATGTAATGAATATGTCTGAAAC