Previous Contig 013374:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS024E02Sequence441013374 (2)gb:AY058204_15643386e-12Arabidopsis thaliana At1g52190/F9I5_4 mRNA, complete cds.>gb:AY098981_1576541 Ar
JMSF041M24Sequence766020114gb:AY099590_15766154e-40Arabidopsis thaliana putative transport protein (At3g16180) mRNA, partial cds.721013374 (2)gb:AY099590_15766155e-38Arabidopsis thaliana putative transport protein (At3g16180) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS024E02+ AGCAAAACAAAACAAGACATCAACTGTGGCTG
                      ____________________________________________________________
consensus AGCAAAACAAAACAAGACATCAACTGTGGCTG
 
. : . : . : . : . : . :
JMFS024E02+ GAGATCAACACGGCTACCACTTCCGCTTTTACGAGGTCAGGTTTCTCGTATGTTATTATT
                      ____________________________________________________________
consensus GAGATCAACACGGCTACCACTTCCGCTTTTACGAGGTCAGGTTTCTCGTATGTTATTATT
 
. : . : . : . : . : . :
JMFS024E02+ TAGTATCTTTACATTATTTATGTCTAACATATATACCATATGCATGTTAAGATATATATA
                      ____________________________________________________________
consensus TAGTATCTTTACATTATTTATGTCTAACATATATACCATATGCATGTTAAGATATATATA
 
. : . : . : . : . : . :
JMFS024E02+ TATATATATATATATATATATATATATATATATATATATATATATATATATATATATATG
rJMSF041M24- ATATATATATATATATG
                      ____________________________________________________________
consensus TATATATATATATATATATATATATATATATATATATATATATATATATATATATATATG
 
. : . : . : . : . : . :
JMFS024E02+ TTCCTAGTTGACTTGTTTTACGACTCATGTTCTTCTTCAATCTTCCTCCATGGCCACTGG
rJMSF041M24- TTCCTAGTTGACTTGTTTTACGACTCATGTTCTTCTTCAATCTTCCTCCATGGCCACTGG
                      ____________________________________________________________
consensus TTCCTAGTTGACTTGTTTTACGACTCATGTTCTTCTTCAATCTTCCTCCATGGCCACTGG
 
. : . : . : . : . : . :
JMFS024E02+ TTTCTCGTCTTTAGAAGGACCATAAGACCTGCTACAAATTAGAAACAGGAGAAAGTTAAC
rJMSF041M24- TTTCTCGTCTTTAGAAGGACCATAAGACCTGCTACAAATTAGAAACAGGAGAAAGTTAAC
                      ____________________________________________________________
consensus TTTCTCGTCTTTAGAAGGACCATAAGACCTGCTACAAATTAGAAACAGGAGAAAGTTAAC
 
. : . : . : . : . : . :
JMFS024E02+ CATGCTTAACCCAGCAAGAACCCAGTAGAAGTAATCATAGTGACCCTCGTTTATGTCGCT
rJMSF041M24- CATGCTTAACCCAGCAAGAACCCAGTAGAAGTAATCATAGTGACCCTCGTTTATGTCGCT
                      ____________________________________________________________
consensus CATGCTTAACCCAGCAAGAACCCAGTAGAAGTAATCATAGTGACCCTCGTTTATGTCGCT
 
. : . : . : . : . : . :
JMFS024E02+ TGTTATCCAACTCCCATTTCCACTATTTATGCTCAATTCGTTGATGCTG
rJMSF041M24- TGTTATCCAACTCCCATTTCCACTATTTATGCTCAATTCGTTGATGCTGCTCATCAGCAA
                      ____________________________________________________________
consensus TGTTATCCAACTCCCATTTCCACTATTTATGCTCAATTCGTTGATGCTGCTCATCAGCAA
 
. : . : . : . : . : . :
rJMSF041M24- GCTCGCCAAGGAATAGCCAAGCGCGTAAAGAGTGGAAGCTATAGTCGACATGCTTCGGGG
                      ____________________________________________________________
consensus GCTCGCCAAGGAATAGCCAAGCGCGTAAAGAGTGGAAGCTATAGTCGACATGCTTCGGGG
 
. : . : . : . : . : . :
rJMSF041M24- AAATTCAGAAATGAAGAACTGGTTCTGTGCCACAGCATTGGACCCCACTGCGATTCCCAT
                      ____________________________________________________________
consensus AAATTCAGAAATGAAGAACTGGTTCTGTGCCACAGCATTGGACCCCACTGCGATTCCCAT
 
. : . : . : . : . : . :
rJMSF041M24- GAGCGCATACTGCGGCACTACCCATAGTATTGACATTTTACTATCTCCGAGGTTGTCTGA
                      ____________________________________________________________
consensus GAGCGCATACTGCGGCACTACCCATAGTATTGACATTTTACTATCTCCGAGGTTGTCTGA
 
. : . : . : . : . : . :
rJMSF041M24- TGAGTGTTCCTGTTTGATTGCAAGGCTTCGTCGGATGCTCTCTACTTTGCCCACCAGGAC
                      ____________________________________________________________
consensus TGAGTGTTCCTGTTTGATTGCAAGGCTTCGTCGGATGCTCTCTACTTTGCCCACCAGGAC
 
. : . : . : . : . : . :
rJMSF041M24- TGCATACCAGAAGGACACAAAGATCCCAAATCCCATTCTTGATTTGGTGCCNAAATGGAC
                      ____________________________________________________________
consensus TGCATACCAGAAGGACACAAAGATCCCAAATCCCATTCTTGATTTGGTGCCNAAATGGAC
 
. : . : . : . : . : . :
rJMSF041M24- TGTGTTTCCTCTGATTCTTGATGCTACAGGCAGGAGTAGTCTGTCGTATAATACTATCCA
                      ____________________________________________________________
consensus TGTGTTTCCTCTGATTCTTGATGCTACAGGCAGGAGTAGTCTGTCGTATAATACTATCCA