Previous Contig 013366:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF041L08Sequence107007437 (2)719013366 (2)gb:AB011474_15113448e-36Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2A18.
JMSF045I13Sequence127007437 (2)560013366 (2)gb:AB011474_15113442e-43Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2A18.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF045I13+ TGTCTTTGCT
                      ____________________________________________________________
consensus TGTCTTTGCT
 
. : . : . : . : . : . :
rJMSF045I13+ GGACACATGCAAGCTGAGCATGCCCTTCAGAGAGATCGTCAGAACATGGGGAGGAGGTAT
rJMSF041L08+ GGACACATGCCAGCTGAGCATGCCCTTCAGAGAGATCGTCAGANCAT-GGGAGGAGGTAT
                      ____________________________________________________________
consensus GGACACATGCCAGCTGAGCATGCCCTTCAGAGAGATCGTCAGAACATGGGGAGGAGGTAT
 
. : . : . : . : . : . :
rJMSF045I13+ GTTGAAGTTTTCAGGTGCAAGAAACAGGATTACTATCAAGCTATATCTGCTGAGGTGAAG
rJMSF041L08+ GTTGAAGTTTTCAGGTGCAAGAAACAGGATTACTATCAAGCTATATCTGCTGAGGTGAAG
                      ____________________________________________________________
consensus GTTGAAGTTTTCAGGTGCAAGAAACAGGATTACTATCAAGCTATATCTGCTGAGGTGAAG
 
. : . : . : . : . : . :
rJMSF045I13+ GACACAGGTGTTGAAAATGATTACCACGGTTCTTCCCCTCCACATCGACCTAAGAGGACC
rJMSF041L08+ GACACAGGTGTTGAAAATGATTACCACGGTTCTTCCCCTCCACATCGACCTAAGAGGACC
                      ____________________________________________________________
consensus GACACAGGTGTTGAAAATGATTACCACGGTTCTTCCCCTCCACATCGACCTAAGAGGACC
 
. : . : . : . : . : . :
rJMSF045I13+ CAGAACAAGGATCAGATGGAGTATACTGAGATATTGAAGTTGCGTGGGCTTCCATTCTCT
rJMSF041L08+ CAGAACAAGGATCAGATGGAGTATACTGAGATATTGAAGTTGCGTGGGCTTCCATTCTCT
                      ____________________________________________________________
consensus CAGAACAAGGATCAGATGGAGTATACTGAGATATTGAAGTTGCGTGGGCTTCCATTCTCT
 
. : . : . : . : . : . :
rJMSF045I13+ GTAAAGAAAGCAGATATTATCAAGTTTTTCGGTGGGGATTTCAATTTGACAGACAACAAA
rJMSF041L08+ GTAAAGAAAGCAGATATTATCAAGTTTTTCGGTGGGGATTTCAATTTGACAGACAACAAA
                      ____________________________________________________________
consensus GTAAAGAAAGCAGATATTATCAAGTTTTTCGGTGGGGATTTCAATTTGACAGACAACAAA
 
. : . : . : . : . : . :
rJMSF045I13+ GTTCACATTGCATACCGACCTGATGGGAAGGCTACTGGAGAGGCATATGTAGAATTTCCC
rJMSF041L08+ GTTCACATTGCATACCGACCTGATGGGAAGGCTACTGGAGAGGCATATGTAGAATTTCCC
                      ____________________________________________________________
consensus GTTCACATTGCATACCGACCTGATGGGAAGGCTACTGGAGAGGCATATGTAGAATTTCCC
 
. : . : . : . : . : . :
rJMSF045I13+ TCATCTGAGGAGGCCAAGAATGCCATGTGCAAGGACAATATGATGATCGGATCAAGATAC
rJMSF041L08+ TCATCTGAGGAGGCCAAGAATGCCATGTGCAAGGACAATATGATGATCGGATCAAGATAC
                      ____________________________________________________________
consensus TCATCTGAGGAGGCCAAGAATGCCATGTGCAAGGACAATATGATGATCGGATCAAGATAC
 
. : . : . : . : . : . :
rJMSF045I13+ ATCGAGCTATTTCCTTCAAGTCAGGATGAATCAAGGAGAGCCGAGTCTAGGTCAAGACAG
rJMSF041L08+ ATCGAGCTATTTCCTTCAAGTCAGGATGAATCAAGGAGAGCCGAGTCTAGGTCAAGACAG
                      ____________________________________________________________
consensus ATCGAGCTATTTCCTTCAAGTCAGGATGAATCAAGGAGAGCCGAGTCTAGGTCAAGACAG
 
. : . : . : . : . : . :
rJMSF045I13+ TAATGCCGAGGTCTCTCAAATGGAGTAATATGAAATCTTTTTATTGCTCAAAAGCCATTT
rJMSF041L08+ TAATGCCGAGGTCTCTCAAATGGAGTAATATGAAATCTTTTTATTGCTCAAAAGCCATTT
                      ____________________________________________________________
consensus TAATGCCGAGGTCTCTCAAATGGAGTAATATGAAATCTTTTTATTGCTCAAAAGCCATTT
 
. : . : . : . : . : . :
rJMSF045I13+ AGTGCTTTCT
rJMSF041L08+ AGTGCTTTCTTTTTGGGGCTGACCTTTCAGCATTTGTTAAAAATTTACCATTCCCATGTT
                      ____________________________________________________________
consensus AGTGCTTTCTTTTTGGGGCTGACCTTTCAGCATTTGTTAAAAATTTACCATTCCCATGTT
 
. : . : . : . : . : . :
rJMSF041L08+ TGGTGGATTTTATTACTGTATTTCCTAAAGACAAGTGTAGTATTTTTATAGAAAATTCAG
                      ____________________________________________________________
consensus TGGTGGATTTTATTACTGTATTTCCTAAAGACAAGTGTAGTATTTTTATAGAAAATTCAG
 
. : . : . : . : . : . :
rJMSF041L08+ TAAACTCCTGGATATGTAGGTTTGGTTAACTTGCTGCAGCTTTGCTGTTTTCTCCAGTTA
                      ____________________________________________________________
consensus TAAACTCCTGGATATGTAGGTTTGGTTAACTTGCTGCAGCTTTGCTGTTTTCTCCAGTTA