Previous Contig 013355:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023M21Sequence481013355 (20)gb:AB038037_15191619e-60Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.673013355 (20)gb:AB038037_15191615e-70Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.
JMFF026A17Sequence558013355 (20)gb:AB038037_15191614e-70Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.639013355 (20)gb:AB038037_15191615e-70Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.
JMFF032K19Sequence504013355 (20)gb:AB038037_15191612e-60Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.596013355 (20)gb:AB038037_15191614e-70Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.
JMFF033K24Sequence570013355 (20)gb:AB038037_15191614e-70Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.372013355 (20)gb:LES270962_16845223e-38Lycopersicon esculentum partial mRNA for putative ferredoxin, clone mo5-10G1.
JMFF037M11Sequence519013355 (20)gb:AB038037_15191612e-60Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.684013355 (20)gb:AB038037_15191616e-70Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.
JMFN010J10Sequence606013355 (20)gb:AB038037_15191614e-70Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.
JMFN010J12Sequence606013355 (20)gb:AB038037_15191614e-70Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.
JMFN014P03Sequence591013355 (20)gb:AB038037_15191611e-60Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.
JMFN015H15Sequence618013355 (20)gb:AB038037_15191615e-70Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.
JMFN030A21Sequence610013355 (20)gb:AB038037_15191614e-70Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.
JMFN033N12Sequence636013355 (20)gb:AB038037_15191615e-70Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.
JMFN037L08Sequence249013355 (20)gb:AB038037_15191612e-12Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.
JMFN043F14Sequence573013355 (20)gb:AB038037_15191611e-63Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.
JMSF037I05Sequence669019949gb:AB038037_15191614e-58Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.756013355 (20)gb:AB038037_15191617e-70Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.
JMSF041J03Sequence548020106658013355 (20)gb:AB038037_15191613e-32Ipomoea nil mRNA for non-photosynthetic ferredoxin, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN043F14- CAGGAAATTGAAAAGGATAGCATTACATTAACTGAAACAACAAT-GTTG
JMFN010J12+ GGAAATTGAAAAGGATAGCATTACATTAACTGAAACAACAAT-GTTG
rJMFF037M11- TAGCATTACATTAACTGAAACAACAAT-GTTG
rJMSF037I05- GCATTACATTAACTGAAACAACAATGGTTG
rJMFF033K24- ACAAT-GTTG
JMFN010J10+ GGAAATTGAAAAGGATAGCATTACATTAACTGAAACAACAAT-GTTG
rJMFF032K19- ATTAACTGAAACAACAAT-GTTG
JMFN033N12+ AATTGAAAAGGATAGCATTACATTAACTGAAACAACAAT-GTTG
JMFN014P03+ CAAT-GTTG
rJMFF026A17- TAGCATTACATTAACTGAAACAACAAT-GTTG
JMFN015H15+ ACAAT-GTTG
JMFN030A21+ ATAGCATTACATTAACTGAAACAACAAT-GTTG
rJMFF023M21- AATTGAAAAGGATAGCATTACATTAACTGAAACAACAAT-GTTG
                      ____________________________________________________________
consensus CAGGAAATTGAAAAGGATAGCATTACATTAACTGAAACAACAAT-GTTG
 
. : . : . : . : . : . :
JMFN043F14- AAGGAGTGGACACTGAGAATCAAGACCCTAATCCTGAGAGTTTTTGGAGTTTTTCAGCAT
JMFN010J12+ AAGGAGTGGACACTGAGAATCAAGACCCTAATCCTGAGAGTTTTTGGAGTTTTTCAGCAT
rJMFF037M11- AAGGAGTGGACACTGAGAATCAAGACCCTAATCCTGAGAGTTTTTGGAGTTTTTCAGCAT
rJMSF037I05- AAGGAGTGGACACTGAGAATCAAGACCCTAATCCTGAGAGTTTTTGGAGTTTTTCAGCAT
rJMFF033K24- AAGGAGTGGACACTGAGAATCAAGACCCTAATCCTGAGAGTTTTTGGAGTTTTTCAGCAT
JMFN010J10+ AAGGAGTGGACACTGAGAATCAAGACCCTAATCCTGAGAGTTTTTGGAGTTTTTCAGCAT
rJMFF032K19- AAGGAGTGGACACTGAGAATCAAGACCCTAATCCTGAGAGTTTTTGGAGTTTTTCAGCAT
JMFN033N12+ AAGGAGTGGACACTGAGAATCAAGACCCTAATCCTGAGAGTTTTTGGAGTTTTTCAGCAT
JMFN014P03+ AAGGAGTGGACCCTGAGCATCAACCTCCTAATCCTGAGAGTTTTTGGAGTTATTCAGCAT
rJMFF026A17- AAGGAGTGGACACTGAGAATCAAGACCCTAATCCTGAGAGTTTTTGGAGTTTTTCAGCAT
JMFN015H15+ AAGGAGTGGACACTGAGAATCAAGACCCTAATCCTGAGAGTTTTTGGAGTTTTTCAGCAT
JMFN030A21+ AAGGAGTGGACANTGAGAATCAAGACCCTAATCCTGAGAGTTTTTGGAGTTTTTCAGCAT
JMFF026A17+ TTTTCAGCAT
rJMFF023M21- AAGGAGTGGACACTGAGAATCAAGACCCTAATCCTGAGAGTTTTTGGAGTTTTTCAGCAT
JMFF033K24+ GAGTTTTTCAGCAT
                      ____________________________________________________________
consensus AAGGAGTGGACACTGAGAATCAAGACCCTAATCCTGAGAGTTTTTGGAGTTTTTCAGCAT
 
. : . : . : . : . : . :
JMFN043F14- AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
JMFN010J12+ AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
rJMFF037M11- AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
rJMSF037I05- AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
rJMFF033K24- AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
JMFN010J10+ AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
rJMFF032K19- AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
JMFN033N12+ AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
JMFN014P03+ AATGTAGGAGCAACTTCAGTGTATACCTAGTAAAGATCGCTCTCCTTGTGGGTGTGAATC
rJMFF026A17- AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
JMFN015H15+ AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
JMFN030A21+ AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
JMFF026A17+ AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
rJMFF023M21- AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
JMFF033K24+ AATGTAGGAACAACNTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
                      ____________________________________________________________
consensus AATGTAGGAACAACCTAAGTAAATACCTAGTAAAGATCACTCTCCTTGTGGGTGTGAATC
 
. : . : . : . : . : . :
JMFN043F14- ACGCAATCCGAAGTTGGGTAAGAAACACAAGTC-AGACATATCCCTCTTCCATTTGGTTG
JMFN010J12+ ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
rJMFF037M11- ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
rJMSF037I05- ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
JMFF037M11+ TGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
rJMFF033K24- ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
JMFN010J10+ ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
rJMFF032K19- ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
JMFN033N12+ ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
JMFN014P03+ ACGCAATCGTAAGTTGGGTAAGACACACAAGTCCCGTCATATCCCTGTTCCATTTGGTTG
rJMFF026A17- ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
JMFN015H15+ ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
JMFN030A21+ ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
JMFF026A17+ ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
rJMFF023M21- ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
JMFF033K24+ ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
JMFF023M21+ GGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
JMFF032K19+ GTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
                      ____________________________________________________________
consensus ACGCAATCCGAAGTTGGGTAAGAAACACAAGTCAAGACATATCCCTCTTCCATTTGGTTG
 
. : . : . : . : . : . :
JMFN043F14- TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
JMFN010J12+ TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
rJMFF037M11- TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
rJMSF037I05- TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
JMFF037M11+ TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
rJMFF033K24- TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
JMFN010J10+ TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
rJMFF032K19- TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
JMFN033N12+ TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
JMFN014P03+ TCATCGACAAAAGACCCATCAGATTGATCCGCAGAGCTTGTCACGGTCTTCCCAGCACAG
rJMFF026A17- TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
JMFN015H15+ TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
JMFN030A21+ TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
JMFF026A17+ TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
rJMFF023M21- TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
JMFF033K24+ TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
JMFF023M21+ TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
JMFF032K19+ TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
                      ____________________________________________________________
consensus TCATCGAGAAAAGACCCATCAGATTGATCCACAGAGCCTGTCACGGTCTTCCCCGCACAG
 
. : . : . : . : . : . :
JMFN043F14- GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
JMFN010J12+ GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
rJMFF037M11- GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
rJMSF037I05- GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
JMFF037M11+ GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
rJMFF033K24- GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
JMFN010J10+ GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
rJMFF032K19- GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
JMFN033N12+ GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
JMFN014P03+ GTAGAGCATGCCCCGGCCTAGCAAGAGTATGGCAGTTCAACTCCCGCGGCATCAGGTGAA
rJMFF026A17- GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
JMFN015H15+ GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
JMFN030A21+ GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
JMFF026A17+ GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
rJMFF023M21- GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
JMFF033K24+ GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
JMFF023M21+ GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
JMFF032K19+ GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
                      ____________________________________________________________
consensus GTAGAGCATGCCCCGGCCCTGCAAGAGTATGGCAGTTCAACTCCCGCGGCCTCAGCTGAA
 
. : . : . : . : . : . :
JMFN043F14- TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
JMFN010J12+ TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
rJMFF037M11- TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
rJMSF037I05- TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
JMFF037M11+ TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
rJMFF033K24- TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCNTACTCGCCATCTGGACNAGCCAGT
JMFN010J10+ TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
rJMFF032K19- TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
JMFN033N12+ TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
JMFN014P03+ TCCAGAATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGTCAAACCAGT
rJMFF026A17- TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
JMFN015H15+ TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
JMFN030A21+ TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
JMFN037L08+ CCAGGATGTAAGTATCGGCAGGTGCATCAAACTGGTACTCGCCATGTGGACGAACCAGT
JMFF026A17+ TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
rJMFF023M21- TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCCGGACAAACCAGT
JMFF033K24+ TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
JMFF023M21+ TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCCGGACAAACCAGT
JMFF032K19+ TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
rJMSF041J03+ TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
                      ____________________________________________________________
consensus TCCAGGATGTAAGTATCCGCAGGTGCATCAAACTCGTACTCGCCATCTGGACAAACCAGT
 
. : . : . : . : . : . :
JMFN043F14- TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
JMFN010J12+ TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
rJMFF037M11- TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
rJMSF037I05- TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
JMFF037M11+ TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
rJMFF033K24- TTA
JMFN010J10+ TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
rJMFF032K19- TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
JMFN033N12+ TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
JMFN014P03+ TTAACCTTATATACCGTTGATGCAGTCACTCTGTATCGGTCAGCTTTCAAGCCAAATGAC
rJMFF026A17- TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
JMFN015H15+ TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
JMFN030A21+ TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
JMFN037L08+ TTGGCCTTATATACCGGTGATGCAGTCACT-GGTAACGGTCAGGTTTCAAGCCAAATGAT
JMFF026A17+ TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
rJMFF023M21- TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
JMFF033K24+ TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
JMFF023M21+ TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
JMFF032K19+ TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
rJMSF041J03+ TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
                      ____________________________________________________________
consensus TTAACCTTATATACCGCTGATGCAGTCACTCTGTAACGGTCAGCTTTCAAGCCAAATGAT
 
. : . : . : . : . : . :
JMFN043F14- TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
JMFN010J12+ TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
rJMFF037M11- TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
rJMSF037I05- TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
JMFF037M11+ TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
JMFN010J10+ TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
rJMFF032K19- TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
JMFN033N12+ TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
JMFN014P03+ TTATAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
rJMFF026A17- TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
JMFN015H15+ TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
JMFN030A21+ TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
JMFN037L08+ TTAGAGACCCTCTTTTCGGGAAGTAATGGATGATGGGGCTCTTCACAAATGCACTCTTTG
JMFF026A17+ TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
rJMFF023M21- TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
JMFF033K24+ TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
JMFF023M21+ TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
JMFF032K19+ TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
rJMSF041J03+ TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
                      ____________________________________________________________
consensus TTAGAGACCCTCTTTAC-GGAAGTAATGGATGAT-GGGCTCTTCACAAATGCACTCTTTG
 
. : . : . : . : . : . :
JMFN043F14- GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTA
JMFN010J12+ GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
rJMFF037M11- GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
rJMSF037I05- GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
JMFF037M11+ GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
JMFN010J10+ GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
rJMFF032K19- GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
JMFN033N12+ GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
JMFN014P03+ GTTGGGTAACAGGGGCCCTTCTGAACATGCAGGTAGATGCAAGTCTCACAGTTCACATGG
rJMFF026A17- GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
JMFN015H15+ GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
JMFN030A21+ GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
JMFN037L08+ GTGGGGTGTCAGGGGCACTTTTGACCATGCAGGTAGATGGAAGTGTTACAGTCGGCATGG
JMFF026A17+ GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
rJMFF023M21- GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
JMFF033K24+ GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
JMFF023M21+ GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
JMFF032K19+ GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
rJMSF041J03+ GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
                      ____________________________________________________________
consensus GTTGGGTAACAGGGGCACTTCTGAACATGCAGGTAGATGGAAGTCTTACAGTCGACATGG
 
. : . : . : . : . : . :
JMFN010J12+ TTCACCTAAAAGTTGGATTTTC
rJMFF037M11- TTCACCT
rJMSF037I05- TTCACCT
JMFF037M11+ TTCACCT
JMFN010J10+ TTCACCTAAAAGTTGGATTTTC
rJMFF032K19- TTCACCTAAAAGTTGGATTTTCTTTGGGAATCTAAG
JMFN033N12+ TTCACCTAAAAGTTGGATTTTCTTTGGGAATCTAAGGCCG
JMFN014P03+ TTCACCTAAAAGTTGGATTTTCTTTGGGAATCTAAGGCCGGACTT
rJMFF026A17- TTCACCTAAAAGTTGGATTTTCTTTGGGAATCTAAGGCCGGACTTCCGAGGGTAAAGTGA
JMFN015H15+ TTCACCTAAAAGTTGGATTTTCTTTGGGAATCTAAGGCCGGACTTCCGAGGGTAAAGTGA
JMFN030A21+ TTCACCTAAAAGTTGGATTTTCTTTGGGAATCTAAGGCCG
JMFN037L08+ TTCACCTAAAA
JMFF026A17+ TTCACCTAAAAGTTGGATTTTCTTTGGGAATCTAAGGCCGGACTTCCGAGGGTAAAGTGA
rJMFF023M21- TTCACCTAAAAGTTGGATTTTCTTTGGGAATCTAAGGCCGGACTTCCGAGGGTAAAGTGA
JMFF033K24+ TTCACCTAAAAGTTGGATTTTCTTTGGGAATCTAAGGCCGGACTTCCGAGGGTAAAGTGA
JMFF023M21+ TTCACCTAAAAGTTGGATTTTCTTTGGGAATCTAAGGCCGGACTTCCGAGGGTAAAGTGA
JMFF032K19+ TTCACCTAAAAGTTGGATTTTCTTTGGGAATCTAAGGCCGGACTTCCGAGGGTAAAGTGA
rJMSF041J03+ TTCACCTAAAAGTTGGATTTTCTTTGGGAATCTAAGGCCGGACTTCCGAGGGTAAAGTGA
                      ____________________________________________________________
consensus TTCACCTAAAAGTTGGATTTTCTTTGGGAATCTAAGGCCGGACTTCCGAGGGTAAAGTGA
 
. : . : . : . : . : . :
rJMFF026A17- GGCGCGA
JMFN015H15+ GGCGCGAGATG
JMFF026A17+ GGCGCGA
rJMFF023M21- GGCGCGAGATGTGGAAAG
JMFF033K24+ GGCGCGAGATGTGGAAAG
JMFF023M21+ GGCGCGAGATGTGGAAAG
JMFF032K19+ GGCGCGAGATGTGGAAAGACCTTTGATCAGTCCAAGAG
rJMSF041J03+ GGCGCGAGATGTGGAAAGACCTTTGATCAGTCCAAGAGAGAGATTTATAGAGAGTGGGTG
                      ____________________________________________________________
consensus GGCGCGAGATGTGGAAAGACCTTTGATCAGTCCAAGAGAGAGATTTATAGAGAGTGGGTG
 
. : . : . : . : . : . :
rJMSF041J03+ AGTGAGTTATGGCTTTTGGGTTTTGTTGAGAGGCGACGAGTTCAGTGAGTGTTGGGTTAC
                      ____________________________________________________________
consensus AGTGAGTTATGGCTTTTGGGTTTTGTTGAGAGGCGACGAGTTCAGTGAGTGTTGGGTTAC
 
. : . : . : . : . : . :
rJMSF041J03+ NCCGTTCCGTTACCTGCCGCCCATAGATTGATAGATTTTTGTGAATTTTTCTCACTCCAA
                      ____________________________________________________________
consensus NCCGTTCCGTTACCTGCCGCCCATAGATTGATAGATTTTTGTGAATTTTTCTCACTCCAA
 
. : . : . : . : . : . :
rJMSF041J03+ AAGTTAATATGTACTCAATTTTTTTTTTATCTAAAAAGTCAATTAAGTTCTTGAACTTTT
                      ____________________________________________________________
consensus AAGTTAATATGTACTCAATTTTTTTTTTATCTAAAAAGTCAATTAAGTTCTTGAACTTTT
 
. : . : . : . : . : . :
rJMSF041J03+ TTAACCCAACGGGATAGTTCAAGTGACAAATGAGCTCTCTTTGTGGGGGAAAATTTCGGG
                      ____________________________________________________________
consensus TTAACCCAACGGGATAGTTCAAGTGACAAATGAGCTCTCTTTGTGGGGGAAAATTTCGGG
 
. : . : . : . : . : . :
rJMSF041J03+ ATAAGCTCGGGTTCGATTCTCATAAGTGACGATTCCCTTTGGGCCAGCTTCTGCTCCTCT
                      ____________________________________________________________
consensus ATAAGCTCGGGTTCGATTCTCATAAGTGACGATTCCCTTTGGGCCAGCTTCTGCTCCTCT